Human Behavior Exam 2 Study Guide Intro to Genetics There are approximately 25 000 genes in the human body GENES are stretches of DNA that work together to perform specialized functions To better understand genes we need to discuss DNA o DNA is a chemical code that allows us to form develop and live human functioning o Stored in the nucleus of every cell except for red blood cells o Information encoded into DNA determines virtually every observable and many unobservable characteristics o PEOPLE VARY BECAUSE THEIR DNA VARIES o Every person has their own unique sequence of DNA except MZ twins The Structure of DNA Two twisted fibers around each other to form a double helix Each fiber is referred to as a POLYNUCLEOTIDE o Along the backbone of each polynucleotide is a sequence of nucleotides also called BASES Four different bases 1 ADENINE A 2 THYMINE T 3 CYTOSINE C 4 GUANINE G These four bases nucleotides make up the genetic alphabet o How are these polynucleotides held together o Through bonds between the bases Specifically A T G C o The bonds hold the 2 strands of DNA together o The ordering of base pairs is important o Very small divergences can alter drastically what we are studying o Humans and chimps share over 96 of DNA o Humans share 99 9 of their DNA o 1 of DNA is responsible for many of the changes among humans o At various segments along DNA contiguous base pairs work together o These base pairs working together are called GENES What do genes do They code for the production of PROTEINS Proteins are essential for life o Structural proteins o Functional proteins hair fingernails tendons etc coordinates actions and activities of the body Genes are configured on threadlike structures called CHROMOSOMES o The human body contains 23 pairs of chromosomes one pair is inherited maternally and one pair is inherited paternally o Females have 2 X chromosomes and males have X Y o Every person has 2 copies of most genes One from Mom One from Dad The 2 copies make up the entire gene Each copy is called an ALLELE 2 alleles 1 gene polymorphisms For most genes only one allele exists in the population But for a small fraction of genes there are at least 2 alleles in existence o This is called a POLYMORPHISM o Polymorphisms are of utmost interest o For genes that are not polymorphisms alleles don t exist they re simply called copies of genes How do genes vary 1 Single Nucleotide Polymorphisms o ACGAGGACCAGTTA o ACGAGCACCAGTTA 2 Short Tandem repeats STR s o TAGGAATTATTATTATTATTA o TAGGAATTATTATTA 3 Variable number of tandem repeats VNTR s o Same as STR s except more nucleotides are repeated hundreds o Different polymorphisms can affect the functioning of the human body GENOTYPE each person s unique sequence of DNA just genes NOTYPE measurable human characteristics i e Personality traits behaviors PHE How can genes affect phenotypes One gene one disorder OGOD OGOD Polygenic effects Pleiotropic effects o Single gene Single Phenotype o Causal deterministic o Not behavior behavior has multiple factors o NOT result of crime crime is NOT deterministic o No application to behavior POLYGENIC EFFECTS o Many genes Single Phenotype Not deterministic probabilistic PLEIOTROPIC EFFECTS o One gene Not a lot of research Genes and the Environment Multiple Phenotypes Genes and the environment often combine to create different behaviors and different personality traits NOT Nature vs Nurture but Nature AND Nurture Referred to as the Gene Environment Interplay Two main types 1 Gene X Environment Interactions GxE Genetic effects are only visible in certain environments 2 people in the same environment may interpret it and react to it differently because of their unique genotypes o Example 2 boys on the street One may have genes that when paired with a bad environment are triggered into antisocial behavior While the other one s genotypes lack the environmental trigger Beaver s father and father in law cholesterol example GxE can explain why kids from the same family turn out differently o We filter and experience things differently GxE s can explain why rehabilitation efforts work for some but not for others GxE s can explain why the environment does not have the same effect on all people ex Medication side effects Remember Caspi et al s article o They found that the certain gene only had an effect in certain environments o This is a classic example of a GxE A growing body of empirical evidence has revealed the importance of GxE s in the etiology of crime and delinquency 2 Gene X Environment Correlations rGE We often see that an environment is related to a person s behaviors or their personality traits We think that the environment caused this association rGE s refer to the close association between genes and the environment 3 types 1 Passive rGE s 2 Active rGE s 3 Evocative rGE s Passive rGE s o Children receive 2 elements from parents genes environment o They passively receive both from their parents o The environment is largely a reflection of their parent s genetic propensities We are a product of our parent s mixture of genes environment Evocative rGE s Active rGE s o People elicit different responses from their environment based in large part on their genotype o 2 people will elicit 2 responses from the same environment Ex bad temper elicits negative experiences responses from environments attractiveness evokes different responses when people walk into the room o Individuals play an active role in seeking out environments that are compatible with their genetic tendencies o Engage in niche picking o More social people more likely to find themselves in social situations Ex thrill seeking and sky diving delinquent peers you pick the environments you are in including picking friends Which genes may relate to antisocial behaviors Genes responsible for the production transportation and breaking down of neurotransmitters are the most promising What are NEUROTRANSMITTERS chemical messengers that allow for communication between neurons NEUROTRANSMITTERS o Billions of neurons in the human brain o Thousands of connections for each of those billion neurons o Space between neurons SYNAPTIC CLEFT or SYNAPSE Neurons aren t physically connected there s a gap o Neurotransmitters are released from one neuron where they cross the synaptic cleft and relay the message to the adjacent neuron o Neurotransmitters need to be mopped up o 2 ways this is done 1 Transporter proteins reuptake 2 Enzymatic degradation MAOA o If either of