Note that lectures began the 21st of February The week after exam 1 we watched a movie on Tuesday and the following Thursday class was cancelled 2 21 12 GENES Introduction to Genetics There are approximately 25 000 genes in the human body Genes are stretches of DNA that work together to perform specialized functions To better understand genes we need to discuss DNA DNA is a chemical code that allows us to form develop and live human functioning DNA is stored in the nucleus of every cell except for red blood cells Information encoded into DNA determines virtually every observable and many unobservable human characteristic People vary because their DNA varies Every person has their own unique sequence of DNA Except for MZ twins Each person s arrangement of genes is referred to as a genotype Structure of DNA Two fibers twisted around each other to form a double helix Each fiber is referred to as a polynucleotide Along the backbone of each polynucleotide is a sequence of nucleotides also called bases 4 different types of bases A Adenine T Thymine C Cytosine G Guanine These four bases nucleotides make up the genetic alphabet AT always go together CG always go together How are the two polynucleotides held together Through the bonding of bases Specifically A pairs with T and G pairs with C and vice versa These bonds hold these two strands of DNA together Ordering of Base Pairs The ordering of base pairs is very important Very Small divergences can alter drastically what we are studying Humans and chimpanzees share over 96 of their DNA Intro to DNA Humans share approximately 99 9 of their DNA 1 percent of DNA is responsible for many of the changes among the human population At various segments along DNA contiguous base pairs work together These base pairs working together are called genes ATCCAGGGTTAGAAT Thats just the front side the bottom would be redundant to write bc A would know would match up with T etc In reality genes are made up of 1000 or more base pairs What do Genes do They code for the production of proteins Proteins are essential to life Structural Proteins Hair tendons fingernails etc Functional Proteins Coordinate actions and activities of the body Intro to Genetics Genes are configured on threadlike structures called chromosomes The human body contains 23 pairs of chromosomes one pair from mom one from dad Females have two X chromosomes and males have an X and a Y chromosome Every person has two copies of most genes One from mom one from dad The two copies make up the entire gene Each copy is referred to as an allele 2 alleles 1 gene We shouldn t talk about gene for this gene for that what varies is the ALLELE For most genes only one allele exists in the population But for a small fraction of genes there are at least two alleles that are in existence These genes are referred to as polymorphisms Why Example with height Intro to Genetics How do Genes Vary 1 Single nucleotide polymorphisms ACGAGGAACCAGTTA ACGAGCACCAGTTA 2 23 12 2 28 2012 Intro to Genetics Variable number of tandem repeats VCNTRs Different polymorphisms can affect the functioning of the human body Same as STRs except more nucleotides are repeated hundreds Short term tandem repeats STRs TAGGAATTATTATTATTATTA TAGGAATTATTATTA Genotype each person s unique sequence of DNA Phenotype measurable human characteristics E g personal traits behaviors How do genes affect phenotypes One gene one disorder OGOD Polygenic effects Pleiotropic effects OGOD Single gene single phenotype No single gene determine your behavior Polygenic effects Many genes Single phenotype This is false and one gene cannot dictate someone s behavior Genes and the environment often combine to create different behaviors and different personality traits Pleiotropic effect one gene multiple phenotypes Genes and the environment Not nature vs nurture but nature and nurture Referred to as gene environment interplay Two main types of gene environment interplay 1 Gene X environment interactions GxE 2 Gene X environment correlations rGE Gene X Environment Interaction Genetic effects are only visible in certain environments Two people in the same environment may interpret it and react to it differently because of their Ex two siblings in the same environment that turn out to be very different unique genotypes GxEs GxEs can explain why children in the same family turn out differently We filter and experience things differently GxEs can explain why rehabilitation efforts work for some people but not for others GxEs can explain why the environment does not have same effect on all people Remember Caspi et al s article They found that the certain gene only had an effect in certain environment This is a classic example of GxE and delinquency A growing empirical evidence has revealed the importance of GxEs in the etiology of crime We often see that an environment is related to a person s behaviors or their personality traits RGEs refers to the close association between genes and the environment Children receive two elements from their parents genes and an environment Passively receive both from their parents The environment is largely a reflection of their parents genetic propensities Previous example with IQ rGEs Passive rGEs 3 1 12 Evocative RGE s People elicit certain responses from their environment based in large part on their genotype Engage in niche picking Example thrill seeking and skydiving delinquent peers What accounts for variation in our environment We choose them Ex Some people are thrill seekers Some people jump off airplanes Genes responsible for the production transportation and breaking down of neurotransmitters are the most promising Which genes may relate to antisocial behavior What are neurotransmitters Neurotransmitters are released from one neuron where they cross the synaptic cleft and relay the message to the adjacent neuron If either of these two processes malfunctions then changes in emotions temperament and behaviors can occur In addition certain medications get their pharmacological properties by altering levels of neurotransmitters Chemical messengers that allow for communication between neurons Neurotransmitters billion of neurons in the human brain thousands of connections for each neuron Space between neurons synaptic cleft or synapse Neurotransmitters Synapse See Diagram of a Synapse Two Processes Reuptake and Enzymes Neurotransmitters SSRIs MAOIs Dopamine Eating Sex Dopamine is part of the pleasure or reward system of the