DNA Replication1. Enzymes, gyrase and helicase, unwind the parental double helix at a site called the origin of replication.2. Proteins stabilize the unwound parental DNA creating the replication fork.3. Beginning with an RNA primer complementarily base paired to the single stranded parental DNA, theleading strand is synthesized continuously by the enzyme DNA polymerase in the direction of thereplication fork. New tri-phosphate nucleotides from the cytoplasm/nucleoplasm are complementarily base paired with the parental strand and chemically bonded to the 3’end of the RNA primer and subsequently to each other at the 3’ends (via removal of two phosphates) to create anew DNA strand.4. The lagging strand is synthesized discontinuously:At the replication fork an RNA primer complementarily pairs with the single stranded parental DNA.Nucleotides are complementarily base paired to the single stranded DNA molecule and bonded to the3’ end of the RNA primer and growing chain by DNA polymerase, working away from the replication fork for ~1000bases. The resulting segment is called an Okazaki fragment.5. As the replication fork moves forward, the leading strand continues to have nucleotides added to the 3’end. The lagging strand begins another Okazaki fragment. DNA polymerase digests the RNA primers on completed Okazaki fragments on the lagging strand and replaces them with DNA nucleotides.6. As each Okazaki fragment ends at the beginning of the previous one, the enzyme DNA ligase bonds theneighboring fragments into a single continuous molecule.7. Replication continues down the full length of the chromosome until both parental strands are completelyseparated and each is base paired to a newly synthesized strand.Amy Warenda Czura, Ph.D.1SCCC BIO244 Chapter 8 HandoutTranscriptionPromoterPromoterOpen Reading Frame (ORF)Open Reading Frame (ORF)((codons codons for amino acids)for amino acids)TerminatorTerminatorStart codonStop codonGene StructureThe Promoter and Terminator are directions for RNA polymerase to indicate the location of the gene to betranscribedThe start and stop codons are directions for the ribosome to indicate where the amino acid information fortranslation begins and endsThe ORF is the “coding” region of the gene: it begins at the start codon and contains in order all the codonsfor all the amino acids in the resulting protein. (3 bases of DNA = 1 codon, each codon indicates one ofthe 20 amino acids) The ORF ends at the stop codon.Amy Warenda Czura, Ph.D.2SCCC BIO244 Chapter 8 HandoutThe Genetic CodeAmy Warenda Czura, Ph.D.3SCCC BIO244 Chapter 8 HandoutTranslationAmy Warenda Czura, Ph.D.4SCCC BIO244 Chapter 8 HandoutThe Lac Operon - inducible gene systemI = regulatory gene located upstream of the operon, constitutively expresses repressor proteinP = promoter, binds RNA polymerase for transcriptionO = operator, binds repressor protein to block transcription of following genes by RNA polymeraseZ, Y, A = genes that encode the enzymes necessary for the catabolism of lactose (uptake and utilization)1. I is constitutively expressed producing active repressor protein.2. Repressor protein binds O and blocks transcription of Z, Y, A by RNA polymerase. No mRNA transcripts areproduced, and thus no translation of lactose utilization enzymes occurs. No enzymes, no lactose catabolismpathway.3. If lactose becomes present, it will bind to repressor protein as an inducer causing inactivation of the repressorprotein. Inactive repressor protein does not bind to/ detaches from the operator.4. . RNA polymerase binds P and transcribes genes Z, Y, A which are translated into lactose utilization enzymes.Lactose is catabolized by the cell.5. As lactose is used by the cell it is taken off the repressor protein, the active repressor binds O and gene transcriptionis shut down again.OAmy Warenda Czura, Ph.D.5SCCC BIO244 Chapter 8 HandoutThe Tryptophan Synthesis Operon - repressible gene systemI = regulatory gene located upstream of the operon, constitutively expresses repressor proteinP = promoter, binds RNA polymerase for transcriptionO = operator, binds repressor protein to block transcription of following genes by RNA polymeraseE, D, C, B, A = genes that encode the enzymes necessary for the tryptophan synthesis pathway1. I is constitutively expressed producing inactive repressor protein.2. RNA polymerase binds P and transcribes genes E, D, C, B, A which are translated into tryptophan synthesisenzymes. Tryptophan is produced and utilized in protein assembly.3. If excess tryptophan accumulates in the cell, it binds to repressor protein acting as a corepressor to activate therepressor protein.4. Repressor protein + corepressor tryptophan bind O and block transcription of E, D, C, B, A by RNA polymerase.No mRNA transcripts are produced, and thus no translation of tryptophan synthesis enzymes occurs. Noenzymes, no tryptophan synthesis pathway, no tryptophan synthesis.5. As tryptophan is used by the cell it is taken off the repressor protein, the repressor unbinds O and gene transcriptionbegins again.Amy Warenda Czura, Ph.D.6SCCC BIO244 Chapter 8 HandoutTranscription/Translation Practice: Given the following coding strand of DNA, provide the sequence of the template strand of DNA, the mRNA molecule that would be transcribed from this gene, and the order of amino acids in the protein that results from translation. Additionally provide the anticodon that would be found on the tRNA for every codon in the mRNA. Coding strand DNA: ATGTTACGCGACCTAACGGGTTCCTGGCATTAG Template strand DNA: mRNA: protein: restate mRNA codons: order of tRNAs to arrive at ribosome (list anticodons): Amy Warenda Czura, Ph.D.7SCCC BIO244 Chapter 8 HandoutAmy Warenda Czura, Ph.D.8SCCC BIO244 Chapter 8