Introduction• How do we detect genes?1. Detecting phenotypic changes in the organism due to changes in the gene.2. Screening DNA sequences for ORFs with gene-like features or similaritiesto genes already known.• A mutation is a change in base sequence of a gene, or in the arrangement ofgenes on a chromosome (chromosome mutation, discussed more later).• A mutation produces a new allele of the gene.• The most common allele in a laboratory stock or wild population of anorganism is called the wild type allele; then a mutation produces a newmutant allele.• A mutant is an individual carrying a mutant allele.Wild type Drosophila on the left; each of the three mutants is in a different gene.Some Kinds of MutationsACCATGA δTGAAACCATGA δTGAGACCATGADeletion δTATGTTCACCATGAATGTTACCATGAATGGACCATGAinsertionACGACCATGAAAGACCATGAAGGACCATGAbase pair substitutionATGACCATGAwild type• Changes of 1 bp (or a few contiguous bp) are called point mutations.• Also possible but much less frequent are substitutions of ≥ 2 bp at onetime.• Transposable elements cause insertions of 102 - 104 bp.Mechanisms of Point Mutation (partial list)1. Most are due to errors in DNA replication: replication repairGATC --> GATC --> GATC or GGTCCTAG CCAG CTAG CCAGRepair occurs during proofreading or later.Slip-strand mispairing causes short repeats: NNNNNNAGCAGCAGC … NNNe.g. Huntington’s disease, (AGC)n, an in-frame repeat encoding poly(Glu). Theresulting polypeptide causes cell death in parts of the brain and dominantneurological problems. (N stands for nucleotide, i.e. any base.)2. Some are due to spontaneous changes in bases, e.g. C --> deamination --> UMechanisms of Point Mutation (continued)3. Some mutations are caused by mutagensChemical mutagens modify bases so they cause mispairing when replicated orare repaired incorrectly.UV radiation links adjacent pyrimidines to form dimers, which may be repairedincorrectly.Ionizing radiation induces single- or double-stranded breaks, chemicallymodifies bases, or cross-links bases; may be repaired incorrectly.H. J. MullerWhen and Where Mutations HappenMutations are stochastic events (unpredictable, random): we can never predict exactlywhen a mutation will occur or what kind of mutation will occur, but we can assign aprobability (frequency or mutation rate) to it.Most mutations happen during cell division, so we usually measure the rate in mutationsper cell division.Measured mutation rate would be 7 mutations/31 cell divisions or 0.226 mutations/cell division(unrealistically high example!).When and Where Mutations HappenIn eukaryotes, mutations that occur in the somatic cells (somatic mutations) are notinherited; mutations that occur any time in the germ line are inherited. We usually measurethe rate in mutations per gametesomatic mutationgerm line mutationGerm lineSomaMutation RatesMutations are stochastic events (unpredictable, random): we can never predict exactly whena mutation will occur or what kind of mutation will occur. We can measure the rate atwhich a given kind of mutation will occur. The rate is the probability that it will occur in aunit of time. Orders of magnitude:animals and plants10-6 - 10-4 muts per gene per gamete10-10 - 10-8 muts per bp per year (from evolution rates)10-9 muts/bp × year × 3 × 10 9 bp > 1 new mutation in each gamete (we are all mutants!)Drosophila: u = 8.4 × 10-9 muts/bp × year U = 1.2 detrimental mutations/2N genomebacteria10-10 - 10-6 muts per gene per cell divisionHow to write rates so they can be used in dimensional analysis:10-9 muts per bp per year10-9 muts/bp × yearNOT 10-9 muts/bp/yearbecause that is 10-9 muts × year /bpMutagenesis increases the rate (probability) but the mutations are still stochastic.Mutation RatesA given mutagen increases the rate of some kinds of mutations but not others. In otherwords, it biases the probabilities, like weighting a coin.e.g.• Ionizing radiation induces (increases the probability of) chromosome breaks and hence oflarge-scale “chromosome mutations” or rearrangements such as deletions ortranslocations.• Acridines induce deletion or insertion frameshifts.• Ethyl methan sulfonate (EMS) induces chemical changes in bases, mainly changingguanine to O6-ethylguanine which mispairs, resulting in changing GC pairs to AT.• 5-bromouracil (Bu) is an analogue of thymine and is most often incorporated into DNA inplace of thymine. It then pairs with G at the next replication, so that an AT pair isreplaced by a GC pair. Less commonly it causes a GC pair to be replaced by AT.Modern genetic engineering can reduce or eliminate the stochasticity of mutation, allowingus to change a specific base in a specific gene in vitro, then put it back in the organism.Knockout mutations can be made in specific genes in vivo.Phenotypic Effects of Mutations in ExonsReview code properties:• Degenerate• Triplet• Commaless• Start codon• Stop codon(s)Phenotypic Effects of MutationsUseful terms for phenotypes of mutations:Amorph = nullimorph = null = knockout mutations: mutant allele iscompletely inactive (not transcribed, or translated, or encodes inactiveprotein or RNA).e.g. white eye mutant in Drosophila melanogasterHypomorph: mutant allele has reduce activity (reduced rate oftranscription or translation, or encodes protein or RNA with reducedactivity).e.g. apricot eye allele of white gene in D. melanogasterNeomorph = gain-of-function mutation: mutant allele has new activity(e.g. encodes protein or RNA with new enzymatic activity or turns onegene off and another one on or make a gene active in wrong tissue).e.g. Antennapedia in DrosophilaThe “morph” terminology was devised by H. J. Muller, who used itmainly to refer to mutation effects inferred from phenotypic effects.Consequences of Code PropertiesDegenerateConsequences of Code Properties• Degenerate, therefore in anexon of a protein codinggene there are two kinds ofpoint mutations:Synonymous mutationschange a codon to asynonymous codon and donot change an amino acidNonsynonymous =missense mutationschange an amino acidConsequences of Amino Acid ChangesSynonymous mutations do not change an amino acid.Therefore they usually have no effect on phenotype.Nonsynonymous = missense mutations change anamino acid. The phenotypic effect depends on thenature of the change and the location in the protein:Some changes have no effect on protein function,therefore no effect on phenotype.Changes that are more