Gene Expression: TranslationReminder•Genes that encode proteins are transcribed and the transcript isprocessed to make mRNA.•Next the base sequence in the mRNA must be translated into aminoacid sequences in a polypeptide.•Once polypeptides are formed, they fold up and combine with othermolecules, but this is the realm of biochemistry, not genetics.Review structure of polypeptides; a protein consists of one or morepolypeptides.The Code ProblemDNA and RNA sequences are writtenin an alphabet of 4 different bases: G,A, T (U), C.Protein sequences are written in analphabet of 20 different amino acids.Therefore there must be a code thatrelates a base sequence to an aminoacid sequence.Francis Crick, Leslie OrgelAlex Rich, Jim Watson(and RNA Tie Club ties)George GamowSidney BrennerJ. Heinrich Matthei Marshall NirenbergSevero OchoaThe 20 Amino AcidsImportantfeatures:•Differ only inside chains•Each has three-letter and one-letterabbreviationsYou shouldunderstand thatthe sequence ofamino acids in apolypeptide(protein) can bewritten twoways:Arg Thr Ser SerR T S SPolypeptideshave an N- and aC-terminal AAYou don’t have to memorize these but youdo have to know there are 20 and recognizeamino acid sequences.The Genetic CodeThe code is:• Written in RNA becauseit is the mRNA sequencethat is read.• Universal (almost)Exceptions (small):Vertebrate mitochondriaInvertebrate mitochondriaChloroplastsCiliate nuclearMycoplasma nuclearCandida nuclearetc.• Triplet• Nonoverlapping• Commaless• DegenerateThe Genetic CodeThe code is:•Universal (almost)• Triplet•Degenerate•Nonoverlapping•CommalessCACCAUGGUGCACCUGACUCCUGAG…CACUAAGCUQuadruplet: AUGGUGCACCUGACUCComma: AUGCCGUGCCCACCCUGGOverlaping: AUGGUGCACCUGACUCThe Genetic CodeCACCAUGGUGCACCUGACUCCUGAG…CACUAAGCUMet Val His Leu Thr Pro Glu …. His StopStartUAA, UAG, and UGA arenonsense codons; they do notcode for any amino acid andhence are stop ortermination codons.All the rest are sense codons.AUG is the start codon andcodes for methionine (Met,M).(only one to memorize)Open Reading FramesCACCAUGGUGCACCUGACUCCUGAG…CACUAAGCUMet Val His Leu Thr Pro Glu …. His StopStartAn open reading frame (ORF) is a string of sense codonsstarting with the start codon ATG and flanked at the 3’ endby a stop codon.All genes that code for proteins must have an ORF.Using Open ReadingFrames to Find GenesCACCAUGGUGCACCUGACUCCUGAG…CACUAAGCUMet Val His Leu Thr Pro Glu …. His StopStartA computer program can search a sequence of bases for open readingframes. These are candidates for genes encoding proteins.Problems:Using Open Reading Frames to Find GenesA computer program can search a sequence of bases for open readingframes. These are candidates for genes encoding proteins.Problems:•A gene can be on either strand, but the sequence is only written for one strand.Solution: search both complementary sequences.•A random sequence of bases can have an ORF. Partial solutions: look for longORFs starting with ATG.• Introns can interrupt ORFs. The introns are spliced out of the mRNA leavingonly the exons which form a continuous ORF; but DNA sequences will still havethe introns. Partial solution: look for sequences that often flank introns.Designing computer programs to seach complete genome sequences is a majorproblem in bioinformatics.The Mechanics of Translation1. Translation requires:• Small ribosomal subunit = SSUrRNA + ribosomal proteins• Large ribosomal subunit = LSUrRNA + ribosomal proteins +5SrRNA (eukaryotes)• (Small and large subunits also have S names: 16S, 18S, 23S, etc. Sis for Svedberg units describing how fast something moves in acentrifugal field.)• Aminoacyl tRNAs = transfer RNAs + amino acids• Accessory proteins that promote various steps2. mRNA is translated 5’ to 3’3. Polypeptide is made N-terminal to C-terminalCellular Sites of Transcription & TranslationAfter eukaryotic nuclear genes aretranscribed and processed, themRNA must be moved to thecytoplasm for translation.Prokaryotic genes, and those in thechloroplasts and mitochondria, arenot separated from the sites ofprotein synthesis. Transcriptionand translation proceedsimultaneously.mitochondriagenesmRNAproteinmRNAchloroplastMaking Aminoacyl tRNAsEach tRNA has a specific basesequence, including an anticodonthat can base pair with a codon.A A A A A UU U U U U AAsnLysA A A A A UU U U U U AAsnLysA A A A A UU U UAsnLysAsn U U A U U AAn aminoacyl tRNA synthase recognizes atRNA and its corresponding amino acid andjoins them.The anticodon on the aminoacyl tRNA base-pairs with its codon on the mRNA.A new peptide bond is formed to join theamino acids.WobbleThere are 61 sense codons.However, organisms may not have 61 different tRNAs.1st (5’) base in anticodon can sometimes pair with 2 or 3 bases:pairs with 3rd (3’) base in codon5’ anticodon base E. coli S. cerevisiaeA U -C G GU A or G AG C or U C or U Inosine A, C, or U C or UDon’t need to memorize these; just know basic principle.Translation in More Detail than You Wanted or Need to Know(see text Figure 10.17 for a better diagram)$$ribosomesmallsubunitRibosome Binding, Translation Initiation, andTermination Signals on mRNAsProkaryotes: a special sequence (the “Shine-Delgarno sequence”) isthe ribosome binding site.Eukaryotes: the 5’ end of the mRNA is modified to form the “5’ cap”that initiates ribosome binding.Prokaryotes and eukaryotes: the AUG start codon is the signal toinitiate translation; the nonsense stop codon binds no tRNA and thisstops translation.5’ UTR 3’ UTRUnique Features of Translation in ProkaryotesOne mRNA can encode more than one polypeptide.≥ 2Unique Features of Translation in ProkaryotesTranslation of an mRNA can begin before transcription iscomplete, because these processes are not separated by anuclear membrane.Where the Machinery Comes FromThe machinery for DNA replication and repair, transcription,and translation includes various enzymes and other proteins,as well as rRNAs and tRNAs.Each of these is encoded by genes, which in turn aretranscribed to make RNAs and these are processed in variousways.The enzymes and proteins are themselves translated frommRNAs using the machinery of which they are components.Like all genes, they are subject to mutations that can changethe rate or manner in which they act.Like all genes, they are the