A Brief Review of Genes and DNAGenes are DNAFlourescence micrograph ofalga Olisthodiscus. Chlorophyllautofluoresces red. DNAstained with DAPI fluoresceswhite.•Chloroplasts and cpDNA•Mitochondria and mtDNA•Nucleus and nuDNAGenes and Chromosomes in EukaryotesHuman DNA in one genome is≈ 1 meter long.It is divided into 23 chromosomes.Somatic cells have two sets of 2323 chromosomes.Genes and Chromosomes in Bacteriagene 1 gene 2 gene 3cellSome Definitions• The phenotype of a cell or organism is determinedjointly by the organism’s genotype andenvironment.• The genotype consists of the genes that controlthe trait of interest.• A gene is a segment of a DNA molecule (or RNA insome viruses).• The genome of an organism is (i) the sum of all ofthe DNA in one set of chromosomes (broad sense);(ii) the sum of all of the genes in one set ofchromosomes (narrow sense).Electron micrographVery small circular DNA(this one is knotted!)Original and Space-filling ModelsJim Watson, FrancisCrick, and their originalhand-made modelComputer-built space-filling models of sideview (left) and end view (right)Structural Models of DNAmajorgrooveminorgrooveSome viruses have a single-stranded DNA genome.Structural Models of NucleotidesRemember:• A and G are purines, C and T are pyrimidines• Purines have short name & long base (2 rings); pyrimidines vice versaYou will not be asked to draw these, but should be able to recognize and name them.Structural Models of PolynucleotidesNote 5’to 3’polaritySimplifying a Structural ModelBase PairsDNA Structure: The Final SimplificationA gene is a sequence of bases in one strand of DNA.3' OH – dR – P – dR – P – dR – P – dR – P 5' | | | | T C G A .. ... ... .. A G C T | | | | 5' P – dR – P – dR – P – dR – P – dR – OH 3’3’ T C G A5’ A G C T5’ A G C TAGCTLearn these models and practice drawing them.DNA Structure: The Final SimplificationAGCTDNA sequences are written for the strand that hasthe same sequence as the RNA transcript (“sensestrand”).Sequences are written 5’ to 3’.Human β-globin Gene Determines AminoAcid Sequence of β -globin1 10 20 30 40 50 60 70 80 90 100AcatttgcttctgacacaactgtgttcactagcaactcaaacagacaccATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGC101AAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGgttggtatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggag201acagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccacccttagGCTGCTGGTGGTCTACCCTTGGACCCAGA301GGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGA401TGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGgtgagt501ctatgggacccttgatgttttctttccccttcttttctatggttaagttcatgtcataggaaggggagaagtaacagggtacagtttagaatgggaaaca601gacgaatgattgcatcagtgtggaagtctcaggatcgttttagtttcttttatttgctgttcataacaattgttttcttttgtttaattcttgctttctt701tttttttcttctccgcaatttttactattatacttaatgccttaacattgtgtataacaaaagcaaatatctctgagatacattaagtaacttaaaaaaa801aactttacacagtctgcctagtacattactatttggaatatatgtgtgcttatttgcatattcataatctccctactttattttcttttatttttaattg901atacataatcattatacatatttatgggttaaagtgtaatgttttaaaattttgcatttgtaattttaaaaaatgctttcttcttttaatatactttttt1001gtttatcttatttctaatactttccctaatctctttctttcagggcaataatgatacaatgtatcatgcctctttgcaccattctaaagaataacagtga1101taatttctgggttaaggcaatagcaatatttctgcatataaatatttctgcatataaattgtaactgatgtaagaggtttcatattgctaatagcagcta1201caatccagctaccattctgcttttattttatggttgggataaggctggattattctgagtccaagctaggcccttttgctaatcatgttcatacctctta1301tcttcctcccacagCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGT1401GGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAgctcgctttcttgctgtccaatttctattaaaggttcctttgttccctaagtccaac1501tactaaactgggggatattatgaagggccttgagcatctggattctgcctaataaaaaacatttATwo Alleles of Human β-globin GeneOne change in position 20 of β-globin gene results in sickle-cellanemiaNormal HbA allele glutamate in β-globinATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCMutant HbS allele valine in β-globinATGGTGCACCTGACTCCTGTGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCNext we will review how genes replicate, then how we useenzymes to manipulate genes, then how genes determine thesequence of amino acids in