Stanford CS 262 - Large-Scale Global Alignments Multiple Alignments (33 pages)

Previewing pages 1, 2, 15, 16, 17, 32, 33 of 33 page document View the full content.
View Full Document

Large-Scale Global Alignments Multiple Alignments

Previewing pages 1, 2, 15, 16, 17, 32, 33 of actual document.

View the full content.
View Full Document
View Full Document

Large-Scale Global Alignments Multiple Alignments


Stanford University
Cs 262 - Computational Genomics
Computational Genomics Documents

Unformatted text preview:

Large Scale Global Alignments Multiple Alignments Lecture 10 Thursday May 1 2003 ARACHNE Steps to Assemble a Genome 1 Find overlapping reads 2 Merge good pairs of reads into longer contigs 3 Link contigs to form supercontigs 4 Derive consensus sequence Lecture 10 Thursday May 1 ACGATTACAATAGGTT 3 Link Contigs into Supercontigs Normal density Too dense Overcollapsed Myers et al 2000 Inconsistent links Overcollapsed Lecture 10 Thursday May 1 3 Link Contigs into Supercontigs cont d Find all links between unique contigs Connect contigs incrementally if 2 links Lecture 10 Thursday May 1 3 Link Contigs into Supercontigs cont d Fill gaps in supercontigs with paths of overcollapsed contigs Lecture 10 Thursday May 1 3 Link Contigs into Supercontigs cont d Contig A d A B Contig B Define G V E V contigs E A B such that d A B C Reason to do so Efficiency full shortest paths cannot be computed Lecture 10 Thursday May 1 3 Link Contigs into Supercontigs cont d Contig A Contig B Define T contigs linked to either A or B Fill gap between A and B if there is a path in G passing only from contigs in T Lecture 10 Thursday May 1 4 Derive Consensus Sequence TAGATTACACAGATTACTGA TTGATGGCGTAA CTA TAGATTACACAGATTACTGACTTGATGGCGTAAACTA TAG TTACACAGATTATTGACTTCATGGCGTAA CTA TAGATTACACAGATTACTGACTTGATGGCGTAA CTA TAGATTACACAGATTACTGACTTGATGGGGTAA CTA TAGATTACACAGATTACTGACTTGATGGCGTAA CTA Derive multiple alignment from pairwise read alignments Derive each consensus base by weighted voting Lecture 10 Thursday May 1 Simulated Whole Genome Shotgun Known genomes Flu yeast fly Human chromosomes 21 22 Make realistic shotgun reads Run ARACHNE Align output with genome and compare Lecture 10 Thursday May 1 Making a Simulated Read artificial shotgun read ERRORIZER Simulated read real read Simulated reads have error patterns taken from random real reads Lecture 10 Thursday May 1 Human 22 Results of Simulations Plasmid Cosmid cov 10 X 0 5 X N50 contig 353 Kb 15 Kb 2 7 Kb Mean contig 142 Kb 10 6 Kb 2 0 Kb N50

View Full Document

Access the best Study Guides, Lecture Notes and Practice Exams

Loading Unlocking...

Join to view Large-Scale Global Alignments Multiple Alignments and access 3M+ class-specific study document.

We will never post anything without your permission.
Don't have an account?
Sign Up

Join to view Large-Scale Global Alignments Multiple Alignments and access 3M+ class-specific study document.


By creating an account you agree to our Privacy Policy and Terms Of Use

Already a member?