DNA SequencingDNA sequencingWhich representative of the species?Slide 4Human population migrationsWhy humans are so similarMigration of human variationSlide 8Slide 9Slide 10Slide 11Slide 12DNA Sequencing – OverviewSlide 14DNA Sequencing – vectorsDifferent types of vectorsDNA Sequencing – gel electrophoresisElectrophoresis diagramsChallenging to read answerSlide 20Slide 21Reading an electropherogramOutput of PHRED: a readPyrosequencing / 454Solexa / ABI SOLiDIllumina / Affymetrix genotypingOther technologies in developmentComparisonMethod to sequence longer regionsSlide 30Definition of CoverageRepeatsSequencing and Fragment AssemblyWhat can we do about repeats?Slide 35Slide 36Slide 37Slide 38Strategies for whole-genome sequencingHierarchical SequencingHierarchical Sequencing StrategyMethods of physical mapping1. HybridizationHybridization – Computational ChallengeSlide 45Slide 462. DigestionOnline Clone-by-clone The Walking MethodThe Walking MethodSlide 50Walking off a Single SeedSlide 53Walking off several seeds in parallelSlide 56Whole Genome Shotgun SequencingFragment Assembly (in whole-genome shotgun sequencing)Fragment AssemblySteps to Assemble a Genome1. Find Overlapping ReadsSlide 62Slide 63Slide 642. Merge Reads into ContigsSlide 66Slide 67Slide 68Slide 69Slide 70Overlap graph after forming contigsRepeats, errors, and contig lengthsSlide 73Slide 74Slide 75Slide 764. Derive Consensus SequenceSome AssemblersQuality of assembliesQuality of assemblies—mouseQuality of assemblies—mouseQuality of assemblies—ratHistory of WGAGenomes SequencedDNA SequencingCS262 Lecture 9, Win07, BatzoglouDNA sequencingHow we obtain the sequence of nucleotides of a species…ACGTGACTGAGGACCGTGCGACTGAGACTGACTGGGTCTAGCTAGACTACGTTTTATATATATATACGTCGTCGTACTGATGACTAGATTACAGACTGATTTAGATACCTGACTGATTTTAAAAAAATATT…CS262 Lecture 9, Win07, BatzoglouWhich representative of the species?Which human?Answer one:Answer two: it doesn’t matterPolymorphism rate: number of letter changes between two different members of a speciesHumans: ~1/1,000Other organisms have much higher polymorphism ratesPopulation size!CS262 Lecture 9, Win07, BatzoglouCS262 Lecture 9, Win07, BatzoglouHuman population migrations•Out of Africa, ReplacementSingle mother of all humans (Eve) ~150,000yrSingle father of all humans (Adam) ~70,000yrHumans out of Africa ~40000 years ago replaced others (e.g., Neandertals)Evidence: mtDNA•Multiregional EvolutionFossil records show a continuous change of morphological featuresProponents of the theory doubt mtDNA and other genetic evidenceCS262 Lecture 9, Win07, BatzoglouWhy humans are so similarA small population that interbred reduced the genetic variationOut of Africa ~ 40,000 years agoOut of AfricaH = 4Nu/(1 + 4Nu)CS262 Lecture 9, Win07, BatzoglouMigration of human variationhttp://info.med.yale.edu/genetics/kkidd/point.htmlCS262 Lecture 9, Win07, BatzoglouMigration of human variationhttp://info.med.yale.edu/genetics/kkidd/point.htmlCS262 Lecture 9, Win07, BatzoglouMigration of human variationhttp://info.med.yale.edu/genetics/kkidd/point.htmlCS262 Lecture 9, Win07, BatzoglouHuman variation in Y chromosomeCS262 Lecture 9, Win07, BatzoglouCS262 Lecture 9, Win07, BatzoglouCS262 Lecture 9, Win07, BatzoglouDNA Sequencing – Overview•Gel electrophoresisPredominant, old technology by F. Sanger•Whole genome strategiesPhysical mappingWalkingShotgun sequencing•Computational fragment assembly•The future—new sequencing technologiesPyrosequencing, single molecule methods, …Assembly techniques•Future variants of sequencingResequencing of humansMicrobial and environmental sequencingCancer genome sequencing19752015CS262 Lecture 9, Win07, BatzoglouDNA SequencingGoal:Find the complete sequence of A, C, G, T’s in DNAChallenge:There is no machine that takes long DNA as an input, and gives the complete sequence as outputCan only sequence ~500 letters at a timeCS262 Lecture 9, Win07, BatzoglouDNA Sequencing – vectors+=DNAShakeDNA fragmentsVectorCircular genome(bacterium, plasmid)Knownlocation(restrictionsite)CS262 Lecture 9, Win07, BatzoglouDifferent types of vectorsVECTOR Size of insertPlasmid2,000-10,000Can control the sizeCosmid 40,000BAC (Bacterial Artificial Chromosome)70,000-300,000YAC (Yeast Artificial Chromosome)> 300,000Not used much recentlyCS262 Lecture 9, Win07, BatzoglouDNA Sequencing – gel electrophoresis1. Start at primer (restriction site)2. Grow DNA chain3. Include dideoxynucleoside (modified a, c, g, t)4. Stops reaction at all possible points5. Separate products with length, using gel electrophoresisCS262 Lecture 9, Win07, BatzoglouElectrophoresis diagramsCS262 Lecture 9, Win07, BatzoglouChallenging to read answerCS262 Lecture 9, Win07, BatzoglouChallenging to read answerCS262 Lecture 9, Win07, BatzoglouChallenging to read answerCS262 Lecture 9, Win07, BatzoglouReading an electropherogram1. Filtering2. Smoothening3. Correction for length compressions4. A method for calling the letters – PHRED PHRED – PHil’s Read EDitor (by Phil Green)Several better methods exist, but labs are reluctant to changeCS262 Lecture 9, Win07, BatzoglouOutput of PHRED: a readA read: 500-1000 nucleotidesA C G A A T C A G …A16 18 21 23 25 15 28 30 32 …21Quality scores: -10log10Prob(Error)Reads can be obtained from leftmost, rightmost ends of the insertDouble-barreled sequencing: (1990)Both leftmost & rightmost ends are sequenced, reads are pairedCS262 Lecture 9, Win07, BatzoglouPyrosequencing / 45424Image credits: 454 Life SciencesCS262 Lecture 9, Win07, BatzoglouSolexa / ABI SOLiD25Image credits: Illumina, Applied BiosystemsCS262 Lecture 9, Win07, BatzoglouIllumina / Affymetrix genotyping26Image credits: Illumina, AffymetrixCS262 Lecture 9, Win07, BatzoglouOther technologies in development27CS262 Lecture 9, Win07, BatzoglouComparisonTechnology Read length (bp) Pairing bp / $ de novoSanger 1,000 long-range 1,000 yes454 250 short-range 10,000 yesSolexa/ABI 30 short-range 100,000 maybeSNP chips 1 no 5,000 no28Application Sanger 454 Solexa/ABISNP chipsBacterial sequencing probablyMammalian sequencing? probably notMammalian resequencingexpensive expensiveGenotyping expensive expensive expensiveCS262 Lecture 9, Win07, BatzoglouMethod to sequence longer regionscut many times at random (Shotgun)genomic segmentGet one or two reads from each segment~500 bp ~500 bpCS262 Lecture 9, Win07, BatzoglouReconstructing the
View Full Document
Unlocking...