DNA SequencingNew topic: DNA sequencingWhich representative of the species?Why humans are so similarMigration of human variationSlide 6Slide 7Slide 8DNA sequencing – vectorsDifferent types of vectorsDNA sequencing – gel electrophoresisElectrophoresis diagramsChallenging to read answerSlide 14Slide 15Reading an electropherogramOutput of PHRAP: a readMethod to sequence segments longer than 500Slide 19Definition of CoverageSlide 21RepeatsStrategies for sequencing a whole genomeHierarchical SequencingHierarchical Sequencing StrategyMethods of physical mapping1. HybridizationHybridization – Computational ChallengeSlide 29Slide 302. DigestionOnline Clone-by-clone The Walking MethodThe Walking MethodSlide 34Advantages & Disadvantages of Hierarchical SequencingWalking off a Single SeedWalking off Several Seeds in ParallelNext LectureDNA SequencingLecture 8, Thursday April 24, 2003Lecture 8, Thursday April 24, 2003New topic: DNA sequencingHow we obtain the sequence of nucleotides of a species…ACGTGACTGAGGACCGTGCGACTGAGACTGACTGGGTCTAGCTAGACTACGTTTTATATATATATACGTCGTCGTACTGATGACTAGATTACAGACTGATTTAGATACCTGACTGATTTTAAAAAAATATT…Lecture 8, Thursday April 24, 2003Which representative of the species?Which human?Answer one:Answer two: it doesn’t matterPolymorphism rate: number of letter changes between two different members of a speciesHumans: ~1/1,000 – 1/10,000Other organisms have much higher polymorphism ratesLecture 8, Thursday April 24, 2003Why humans are so similarA small population that interbred reduced the genetic variationOut of Africa ~ 100,000 years agoOut of AfricaLecture 8, Thursday April 24, 2003Migration of human variationhttp://info.med.yale.edu/genetics/kkidd/point.htmlLecture 8, Thursday April 24, 2003Migration of human variationhttp://info.med.yale.edu/genetics/kkidd/point.htmlLecture 8, Thursday April 24, 2003Migration of human variationhttp://info.med.yale.edu/genetics/kkidd/point.htmlLecture 8, Thursday April 24, 2003DNA SequencingGoal:Find the complete sequence of A, C, G, T’s in DNAChallenge:There is no machine that takes long DNA as an input, and gives the complete sequence as outputCan only sequence ~500 letters at a timeLecture 8, Thursday April 24, 2003DNA sequencing – vectors+=DNAShakeDNA fragmentsVectorCircular genome(bacterium, plasmid)Knownlocation(restrictionsite)Lecture 8, Thursday April 24, 2003Different types of vectorsVECTOR Size of insertPlasmid2,000-10,000Can control the sizeCosmid 40,000BAC (Bacterial Artificial Chromosome)70,000-300,000YAC (Yeast Artificial Chromosome)> 300,000Not used much recentlyLecture 8, Thursday April 24, 2003DNA sequencing – gel electrophoresisStart at primer(restriction site)Grow DNA chainInclude dideoxynucleoside(modified a, c, g, t)Stops reaction at allpossible pointsSeparate products withlength, using gel electrophoresisLecture 8, Thursday April 24, 2003Electrophoresis diagramsLecture 8, Thursday April 24, 2003Challenging to read answerLecture 8, Thursday April 24, 2003Challenging to read answerLecture 8, Thursday April 24, 2003Challenging to read answerLecture 8, Thursday April 24, 2003Reading an electropherogram1. Filtering2. Smoothening3. Correction for length compressions4. A method for calling the letters – PHRED PHRED – PHil’s read editor (by Phil Green)Based on dynamic programmingSeveral better methods exist, but labs are reluctant to changeLecture 8, Thursday April 24, 2003Output of PHRAP: a read500-700 nucleotidesA C G A A T C A G …. A16 18 21 23 25 15 28 30 32 21Quality scores: -10log10Prob(Error)Reads can be obtained from leftmost, rightmost ends of the insertDouble-barreled sequencing:Both leftmost & rightmost ends are sequencedLecture 8, Thursday April 24, 2003Method to sequence segments longer than 500cut many times at random (Shotgun)genomic segmentGet one or two reads from each segment~500 bp ~500 bpLecture 8, Thursday April 24, 2003Reconstructing the Sequence (Fragment Assembly)Cover region with ~7-fold redundancy (7X)Overlap reads and extend to reconstruct the original genomic regionreadsLecture 8, Thursday April 24, 2003Definition of CoverageLength of genomic segment: LNumber of reads: nLength of each read: lCoverage C = nl/LHow much coverage is enough?(Lander-Waterman model):Assuming uniform distribution of reads, C=10 results in 1 gapped region /1,000,000 nucleotidesLecture 8, Thursday April 24, 2003Challenges with Fragment Assembly•Sequencing errors~1-2% of bases are wrong•Repeats•Computation: ~ O( N2 ) where N = # readsLecture 8, Thursday April 24, 2003RepeatsBacterial genomes: 5%Mammals: 50%Repeat types:Low-Complexity DNA (e.g. ATATATATACATA…)Microsatellite repeats: (a1…ak)N where k ~ 3-6(e.g. CAGCAGTAGCAGCACCAG)Common Repeat FamiliesSINE (Short Interspersed Nuclear Elements)(e.g. ALU: ~300-long, 106 copies)LINE (Long Interspersed Nuclear Elements)~500-5,000-long, 200,000 copiesMIRLTR/RetroviralOther-Genes that are duplicated & then diverge (paralogs)-Recent duplications, ~100,000-long, very similar copiesLecture 8, Thursday April 24, 2003Strategies for sequencing a whole genome1. Hierarchical – Clone-by-clonei. Break genome into many long piecesii. Map each long piece onto the genomeiii. Sequence each piece with shotgunExample: Yeast, Worm, Human, Rat2. Online version of (1) – Walkingi. Break genome into many long piecesii. Start sequencing each piece with shotguniii. Construct map as you goExample: Rice genome3. Whole genome shotgunOne large shotgun pass on the whole genomeExample: Drosophila, Human (Celera), Neurospora, Mouse, Rat, FuguHierarchical SequencingLecture 8, Thursday April 24, 2003Lecture 8, Thursday April 24, 2003Hierarchical Sequencing Strategy1. Obtain a large collection of BAC clones2. Map them onto the genome (Physical Mapping)3. Select a minimum tiling path4. Sequence each clone in the path with shotgun5. Assemble6. Put everything togethera BAC clonemapgenomeLecture 8, Thursday April 24, 2003Methods of physical mappingGoal: Make a map of the locations of each clone relative to one another Use the map to select a minimal set of clones to sequenceMethods:•Hybridization•DigestionLecture 8, Thursday April 24, 20031. HybridizationShort words, the p robes, attach to complementary words1. Construct many probes2. Treat each BAC with all probes3. Record which ones attach to it4. Same words attaching to BACS X, Y overlapp1pnLecture 8, Thursday April 24, 2003Hybridization – Computational ChallengeMatrix:m probes n
View Full Document
Unlocking...