Biol 151 Quiz 10 17 14 R Phillis Please enter your name and ID number on your answer sheet accurately This quiz has both multiple choice and multiple true false questions Multiple choice questions have lettered answers Choose the single best answer and enter it on your answer sheet Multiple true false questions have numbered answers Determine whether each answer is true or false and record a for true and b for false on your answer sheet 1 If the mRNA for a gene has the following sequence 5 GGCUUGAUGCCAGGCUAGCCACGCUAGAAAAAAAAA 3 What is the amino acid sequence of the protein it could encode a Ser Leu Met Pro Gly Cys Tyr Pro Ser Tyr b Ser Leu Met Pro Gly Cys c Met Pro Gly d Met Pro Gly Tyr Pro Arg e Met Arg Ala Pro Gln Trp Cys Ala Gln Ser The rest of the questions pertain to a gene with the following structure Problem one Analysis of RNA and protein from a mutant form of the gene shows the following Which of the following could have produced these results F2 A deletion of 50 bases from the Regultory region T3 A deletion of the donor site from Intron 2 F4 A deletion of 30bp from Exon 2 F5 A deletion of the palindromic sequence from the 3 end of Exon 3 F6 Blocking SNRP binding from the acceptor site in Intron 1 F7 The change of the stop codon in Exon 3 from UGA to UGG F8 Addition of an extra site for binding of DNA bending transcription factors to the Regulatory region T9 The presence in Intron 2 of an A nucleotide in the RNA that lacks a 2 OH F10 Deletion of the TATA box Don t forget to answer the questions on the back Problem two Which of the following could be observed in a mutant form of the gene that has a deletion of 60 bases from Exon 1 11 F 12 F 13 T 14 F T only if you explain why in an email 15 F 16 T Problem three Which of the following could be caused by the deletion of 60 bases from Intron 1 Intron one is quite large and normally contains 1000 bases The deletion could occur anywhere in Intron 1 17 T 18 T 19 T 20 T 21 F 22 F