DOC PREVIEW
UMass Amherst BIOLOGY 151 - Biol 151 Quiz 101714KEY

This preview shows page 1 out of 2 pages.

Save
View full document
View full document
Premium Document
Do you want full access? Go Premium and unlock all 2 pages.
Access to all documents
Download any document
Ad free experience
Premium Document
Do you want full access? Go Premium and unlock all 2 pages.
Access to all documents
Download any document
Ad free experience

Unformatted text preview:

Biol%151%Quiz%10/17/14%%%R.%Phillis%Please%enter%your%name%and%ID%number%on%your%answer%sheet%accurately.%This%quiz%has%both%multiple%choice%and%multiple%true/false%questions.%%%Multiple%choice%questions%have%lettered%answers.%%Choose%the%single%best%answer%and%enter%it%on%your%answer%sheet.%%%Multiple%true/false%questions%have%numbered%answers.%%Determine%whether%each%answer%is%true%or%false%and%record%(a)%for%true%and%(b)%for%false%on%your%answer%sheet.%%1.%%If%the%mRNA%for%a%gene%has%the%following%sequence:%% % 5’#GGCUUGAUGCCAGGCUAGCCACGCUAGAAAAAAAAA#3’%What%is%the%amino%acid%sequence%of%the%protein%it%could%encode?%a.##Ser.Leu.Met.Pro.Gly.Cys.Tyr.Pro.Ser.Tyr#b.##Ser.Leu.Met.Pro.Gly.Cys#*c.##Met.Pro.Gly#d.##Met.Pro.Gly.Tyr.Pro.Arg##


View Full Document

UMass Amherst BIOLOGY 151 - Biol 151 Quiz 101714KEY

Download Biol 151 Quiz 101714KEY
Our administrator received your request to download this document. We will send you the file to your email shortly.
Loading Unlocking...
Login

Join to view Biol 151 Quiz 101714KEY and access 3M+ class-specific study document.

or
We will never post anything without your permission.
Don't have an account?
Sign Up

Join to view Biol 151 Quiz 101714KEY 2 2 and access 3M+ class-specific study document.

or

By creating an account you agree to our Privacy Policy and Terms Of Use

Already a member?