Name Directions Fill in your ID AND NAME on the scantron and bubble in the letters and numbers For the following questions if the answers are preceded by letters select one answer If the answers are preceded by numbers then each one requires you to indicate whether it is A correct or B incorrect If you wish you can mark your answers on this sheet you may keep it I will post the key online this evening Each question is worth 2 77 points 1 Embryonic blastocyst cells differ from adult skin stem cells because skin stem cells are A B C D Pluripotent Multipotent Totipotent Omnipotent Two second messengers A and B are synthesized at 10 molecules per second but have different lifetimes A lasts 1 second per molecule whereas B lasts 60 seconds Which of the following would be true or false each answer is a separate problem so you should mark A for T or B for F Do the math pay attention to turn over time 2 There would be 600 molecules of B at steady state T 3 B would make a better rapid signaling molecule because its concentration is high F 4 If the cell started synthesizing both molecules at 100 molecules per second but didn t change the turnover time there would be 110 molecules of A after 2 s F 5 A would make a better rapid signaling molecule because its steady state concentration is low T 6 If you change the turnover time 100 times instead of the synthesis rate 10X the increase in concentration would be faster F 7 If the sequence of a eukaryotic gene s promoter region were to mutate what might be the consequence A B C D E The sigma factor could not bind No transcription would occur Transcription of this particular gene would not occur No translation would occur There would be no consequences 8 The central Dogma A B C D E DNA protein RNA RNA DNA protein DNA RNA protein Protein DNA RNA Protein RNA DNA Use this Diagram for the next three questions 9 Which of the following would block the SR signal from reaching the nucleus A If TK1 not only targeted TK2 but also targeted TFa B If TK2 not only targeted TFa but also target TK1 C If TFa caused the production of a phosphatase that targeted TK2 D If TK2 caused ubiquitin dependent proteolysis of TFa 10 Which of the following would set up a positive feedback loop A If TK1 not only targeted TK2 but also targeted TFa B If TK2 not only targeted TFa but also target TK1 C If TFa caused the production of a phosphatase that targeted TK2 D If TK2 caused ubiquitin dependent proteolysis of TFa 11 Which of the following would set up an oscillating output from a constantly present signal A If TK1 not only targeted TK2 but also targeted TFa B If TK2 not only targeted TFa but also target TK1 C If TFa caused the production of a phosphatase that targeted TK2 D If TK2 caused ubiquitin dependent proteolysis of TFa 12 In lane 1 I have added a sample of linear DNA In lane 2 I pre treated the DNA with a protein that cuts the DNA in two unequal pieces Which of the following images shows the correct arrangement of bands A 1 2 1 2 B C D 13 APC stands for adenomatous polyposis coli protein In people with a nonfunctioning mutation in the protein the protein doesn t work the chance of colorectal S cancer by age 40 is 100 because of an over proliferation of cells in the crypts of the intestinal epithelium In healthy cells a signal S is necessary to cause proliferation when APC not shown is non functional no signal is necessary for cell proliferation S is signal the snakey thing is the receptor a dashed line shows several steps TF is a transcription factor leading to expression of genes related to proliferation What might un mutated APC do in a HEALTHY cell Pick the BEST answer A B C D E APC is a kinase for the receptor APC is a kinase for TF APC leads to ubiquitin mediated degradation of TF APC blocks endocytosis of the receptor None of the above TF 14 The phrase survival of the fittest is often used to summarize the complex concept of evolution by natural selection Why is the phrase misleading A B C D E The phrase doesn t account for artificial selection The survivor must pass on his her its genes to offspring for evolution to happen Natural selection does not select for fitness You can t live forever but evolution still occurs None of the above 15 A GTPase is in its inactive state when A B C D E It hydrolyzes GTP It is bound to GDP It is bound to GTP It is activated by a kinase It is ubiquitinated 16 A small number of surface receptors can ultimately generate a large intracellular response as each step of the pathway is often expanded by signal A B C D E amplification transduction negative feedback second messengers Any of the above 17 help adhere cells to one another whereas help to anchor cells to the ECM A B C D Adherins gap junctions Gap junctions tight junctions Tight junctions integrins Cytoskeleton desmosomes 18 AAP is a cytosolic protein that is phosphorylated in its active state Which of the following could inactivate the protein temporarily A B C D E A kinase A phosphatase Ubiquitin mediated degradation Receptor endocytosis Any of the above 19 Transcription begins at a RNA polymerase binding site called a A B C D ribosome replicator inducer promoter 20 In a ribosome assembles a polypeptide whose amino acid sequence is specified by the nucleotide sequence in the mRNA which itself is a copy of the template DNA A B C D transcription translation replication synthesis 21 Most eukaryotic genes contain coding sequences called that are interspersed with noncoding sequences A B C D introns exons codons DNA 22 Amino acids are transported to the ribosome for use in building the polypeptide by A B C D E mRNA molecules tRNA molecules DNA polymerase molecules rRNA molecules DNA ligase molecules 23 The different components of the protein synthesizing machinery include all of the following except A B C D E mRNA tRNA ribosomes amino acids RNA polymerase 24 If the sequence of bases in a section of template DNA is 5 ATCGCTCC 3 what is the corresponding sequence of bases in mRNA A B C D 5 TAGGCTGG 3 5 UAGCGAGG 3 5 GGAGCGAU 3 5 AUCGCUGG 3 The following is a piece of RNA from the middle of a gene If the two highlighted bases were deleted through a mutation which of the following are possible consequences for the organism For each possibility indicate A for possible B for not possible 5 AUGUUUACGGAGCGUAUCGG 3 25 It would not affect the reading frame because it s in an intron T 26 It would disrupt the frame T 27 It would add a single new amino acid to …