Bacteriophages Morphology, Replication, Gene Regulation and Implications for Biomedical Science Terry D. Connell, Ph.D. Dept. of Microbiology & Immunology [email protected] PresentationSlide 3Slide 4Slide 5Slide 6Slide 7Slide 8Slide 9Slide 10Slide 11Slide 12Slide 13Slide 14Slide 15Slide 16Slide 17Slide 18Slide 19Slide 20Slide 21Slide 22Slide 23Slide 24Slide 25Slide 26Slide 27Slide 28Slide 29Slide 30Slide 31Slide 32Slide 33Slide 34Slide 35Slide 36Slide 37Slide 38Slide 39Slide 40Slide 41Slide 42Slide 43Slide 44Slide 45Slide 46Slide 47BacteriophagesBacteriophagesMorphology, Replication,Morphology, Replication,Gene Regulation Gene Regulation and and Implications for Biomedical ScienceImplications for Biomedical ScienceTerry D. Connell, Ph.D.Terry D. Connell, Ph.D.Dept. of Microbiology & ImmunologyDept. of Microbiology & [email protected]@buffalo.eduTwort & d'Herelle phenomenon: lysis of bacteria by bacteriophage1915Why are bacteriophages important organisms?1. Basis for recombinant DNA technologies (T4 ligase, T7 polymerase, cloning, etc.)2. Clinical applications (Bacterial typing, microbicides, , etc.)1. Bacteriophage provide means for genetic exchange (Spread of antibiotic resistance, etc.) 5. Lysogenic conversion alters bacterial virulence properties (Acquisition of genes for bacterial toxins)6. *** Insight into basic Molecular Biological processes (Gene regulation, DNA replication and repair, etc.)Why are bacteriophages important organisms?1. Basis for recombinant DNA technologies (T4 ligase, T7 polymerase, cloning, etc.)2. Clinical applications (Bacterial typing, microbicides, , etc.)1. Bacteriophage provide means for genetic exchange (Spread of antibiotic resistance, etc.) 5. Lysogenic conversion alters bacterial virulence properties (Acquisition of genes for bacterial toxins)6. *** Insight into basic molecular biological processes (Gene regulation, DNA replication and repair, etc.)HOW DO WE CULTUREAND STUDY BACTERIOPHAGES? “Plaque assay” Add serial (1:10) dilutions of potential lysates to molten agar containing bacteriaEach phage to one cell Plate mixture onto solid agar culturemedium Incubate overnight Infection, lysis, more phage, infection of adjacent bacteria, etc. Look for a progressive infection10-510-410-3Serial dilutionsof phage lysateUsed to enumeratethe concentrationof phage in anysolution3 x 106 phage/ml30 plaquesHow do we classify bacteriophages?How do we classify bacteriophages?- Nucleic acid compositionBacteriophage Nucleic Acids1. Double-stranded DNA (T-phages, lambda)2. Single-stranded DNA (M13)3. Double-stranded RNA (Φ6)4. Single-stranded RNA (Qβ)How do we classify bacteriophages?- Nucleic acid composition- ShapeIcosohedral (geodesic dome)Helical (spiral staircase)Helical & IcosohedralΦ6M13lambdaHow do we classify bacteriophages?- Nucleic acid composition- Shape- LifestyleTwo classes of Bacteriophage:Lytic & TemperateClassified on the differences in their replicative lifecyclesTwo classes of Bacteriophage:Lytic & TemperateClassified on the differences in their replicative lifecyclesLyticbacteriophage Lyse and kill the infected bacterial cellsExample: T phages (T4, T35, T55, etc.)>100 progeny phageT4 Phage Lytic Lifecycle-Adsorption-Penetration-Replication“LPS”Steps inthe initialstages of infection of abacterial cellby T4 phage“Phage morphogenesis occurs in a Stepwise progression”Preferential mRNA synthesis > DNA synthesis > protein synthesis > incomplete head assembly > DNA packaging > tail addition > maturation > lysis of cell“Phage morphogenesis occurs in a Stepwise progression”Latent periodPreferential mRNA synthesis > DNA synthesis > protein synthesis > incomplete head assembly > DNA packaging > tail addition > maturation > lysis of cell“Phage morphogenesis occurs in a Stepwise progression”Latent periodEclipse periodPreferential mRNA synthesis > DNA synthesis > protein synthesis > incomplete head assembly > DNA packaging > tail addition > maturation > lysis of cellHeadsand tailsLysisand releaseof Phage Morphogenesis of bacteriophage particlesLatent periodEclipse periodAssemblyofPhageTwo classes of Bacteriophage:Lytic & TemperateClassified on the differences in their replicative lifecyclesTemperatebacteriophage:Lytic & LysogeniclifestylesLatencyLysogenLysogeny is a reversible process !!! Why?Lysogenic incorporation ofphage genome into the bacterial chromosomeLysogeny is a reversible process !!! Why?Lysogenic incorporation ofphage genome into the bacterial chromosomeAdverseConditions!!!Bacteriophage LambdaA temperate bacteriophage“Cos sites”Lambda: Steps in temperate lifestyle1.2.3.4.Annealing ofcomplementaryssDNA at theCos sites(“cohesive’)Circularization of thelinear lambda DNAGGCGGCGACCT-----CCGCCGCTGGACos…CG…GCCCGCCGCTGGAGGCGGCGACCTCG… GC…Partial COS site ssDNA overhangG:C-rich ssDNA? Why G:C rich?Annealing ofcomplementaryssDNA at theCos sites(“cohesive’)Circularization of thelinear lambda DNAGGCGGCGACCT-----CCGCCGCTGGACos…CG…GCCCGCCGCTGGAGGCGGCGACCTCG… GC……CGGGCGGCGACCTCG……GCCCGCCGCTGGAGC…Partial COS site ssDNA overhangAnnealed dsDNA Full COS siteG:C-rich ssDNA? Why G:C rich?Decision!!Molecular decision to Lytic or Lysogenic phagedepends upon:Four promoters: PL(lysis), PRM, PR(lysis), and PRETwo proteins: cI (repressor) & Cro (anti-repressor)Choice determined by which promoter (PR or PRE) becomes initially activated!!Regulation of lambda bacteriophageLysogenic cycleP - promoterscI - lambda repressor of PL and PR transcriptioncro - inhibitor of cI, anti-repressorPRPREPL PRMcI croRegulation of lambda bacteriophageLysogenic cycleP - promoterscI - lambda repressor of PL and PR transcriptioncro - inhibitor of cI, anti-repressorLysis genesLysis genesRepression RepressionActivation12PRPREPL PRMcI croRegulation of lambda bacteriophageLytic cycleP - promoterscI - lambda repressor of PL and PR transcriptioncro - inhibitor of cI (antirepressor)RepressionLysis genes Lysis genesWhat are the subsequent replicative eventsthat occur if thebacteriophage ‘chooses’ the LYTIC lifecycle?COS sitesLytic CycleBidirectionalor“Theta”replicationRollingcirclereplicationInitially,… Theta replicationThen,… Rolling circle