Optional Practice 1 If a gene normally codes for the amino acid sequence Met Tyr Phe Ala Lys Ser Asp Gln which of the following best illustrates the result of a nonsense mutation a Met Tyr Phe Ala Lys b Met Tyr Phe Ala Glu Ser Asp Gln c Met Tyr Phe Ala Lys Ser Asp Gln d Met Tyr Phe Leu Val His Asn Trp 2 Use this template strand from the coding region of a gene for the next three questions 3 AGCAGTACGCTCAGAGGTCGATTAACTGG 5 a If the first nucleotide in the third codon is changed to a different nucleotide due to a point mutation what amino acid s could the third codon now produce b Which type of point mutation occurred above c What would happen to the protein if the underlined guanine nucleotide is deleted a Protein will not be changed b Protein will be shorter than normal e Protein will contain many incorrect amino acids c Protein will be longer than normal d Protein will not be produced 3 Expression of Gene X is enabled when a specific transcription factor binds to its promoter in response to an environmental signal If a frameshift mutation in the gene that encodes the transcription factor results in a non functional protein how will expression of Gene X be affected with or without the environmental signal 4 A DNA molecule shown at right is replicated once in the presence of labeled thymine nucleoSdes Write out the DNA molecules present aTer replicaSon has been completed including direcSonality Underline labeled nucleoSdes 5 Identify the enzymes represented in the figure of a replication fork shown below 5 ACCA 3 3 TGGT 5 A B C D E 6 Which of these enzymes construct nucleoSde strands from 5 to 3 select all that apply a topoisomerase b helicase c primase d DNA polymerase e telomerase 7 A region of DNA undergoing replicaSon is observed with an electron microscope as shown below Label the 5 and 3 ends of the DNA strands used as templates for replicaSon 8 A mutaSon prevents cells from making funcSonal helicases Which of the following would be the most direct e ect of this mutaSon a DNA will twist too Sghtly during replicaSon b Cells will only be able to replicate the leading strand c New replicaSon forks will not be able to form d Cells will only be able to replicate the lagging strand e DNA will have unrepaired breaks in the backbone 9 Which of these are di erences between replicaSon in a cell and PCR select all that apply a RNA is needed for replicaSon in a cell but not for PCR b ReplicaSon in a cell makes one copy while PCR makes many copies c ReplicaSon in a cell copies all of the DNA while PCR copies part of the DNA d Okazaki fragments are needed for replicaSon in a cell but not for PCR e Primers are needed for replicaSon in a cell but not for PCR 10 Select primers that are ve nucleoSdes long to amplify the indicated region below using PCR 11 You grow bacteria in the presence of 15N let the bacteria replicate their DNA and divide once in the presence of 14N extract the DNA and use a centrifuge to examine the DNA density If the conservaSve model of replicaSon was correct what would you expect to see for a result 12 Dogs have 78 chromosomes 39 pairs in their somaSc cells as shown in the gure below How many chromosomes would be in a somaSc cell immediately aTer replicaSon occurs Answers 13 If a gene normally codes for the amino acid sequence Met Tyr Phe Ala Lys Ser Asp Gln which of the following best illustrates the result of a nonsense mutation c Met Tyr Phe Ala Lys d Met Tyr Phe Ala Glu Ser Asp Gln c Met Tyr Phe Ala Lys Ser Asp Gln d Met Tyr Phe Leu Val His Asn Trp 14 Use this template strand from the coding region of a gene for the next three questions 3 AGCAGTACGCTCAGAGGTCGATTAACTGG 5 a If the first nucleotide in the third codon is changed to a different nucleotide due to a point mutation what amino acid s could the third codon now produce Leu Ile Phe b Which type of point mutation occurred above missense c What would happen to the protein if the underlined guanine nucleotide is deleted a Protein will not be changed b Protein will be shorter than normal e Protein will contain many incorrect amino acids c Protein will be longer than normal d Protein will not be produced 15 Expression of Gene X is enabled when a specific transcription factor binds to its promoter in response to an environmental signal If a frameshift mutation in the gene that encodes the transcription factor results in a non functional protein how will expression of Gene X be affected with or without the environmental signal Gene X would never be expressed 16 A DNA molecule shown at right is replicated once in the presence of labeled thymine nucleoSdes Write out the DNA molecules present aTer replicaSon has been completed including direcSonality Underline labeled nucleoSdes 17 Identify the enzymes represented in the figure of a replication fork shown below 5 ACCA 3 3 TGGT 5 5 ACCA 3 3 TGGT 5 5 ACCA 3 3 TGGT 5 A topoisomerase B helicase C DNA polymerase leading D DNA polymerase lagging E DNA ligase 18 Which of these enzymes construct nucleoSde strands from 5 to 3 select all that apply a topoisomerase b helicase c primase d DNA polymerase e telomerase 19 A region of DNA undergoing replicaSon is observed with an electron microscope as shown below Label the 5 and 3 ends of the DNA strands used as templates for replicaSon 3 20 A mutaSon prevents cells from making funcSonal helicases Which of the following would 5 3 5 be the most direct e ect of this mutaSon f DNA will twist too Sghtly during replicaSon g Cells will only be able to replicate the leading strand h New replicaSon forks will not be able to form i Cells will only be able to replicate the lagging strand j DNA will have unrepaired breaks in the backbone 21 Which of these are di erences between replicaSon in a cell and PCR select all that apply f RNA is needed for replicaSon in a cell but not for PCR g ReplicaSon in a cell makes one copy while PCR makes many copies h ReplicaSon in a cell copies all of the DNA while PCR copies part of the DNA i Okazaki fragments are needed for replicaSon in a cell but not for PCR j Primers are needed for replicaSon in a cell but not for PCR 5 TCATC 3 22 Select primers that are ve nucleoSdes long to amplify the indicated region below using PCR 23 You grow bacteria in the presence of 15N let the bacteria replicate their DNA and divide once in the presence of 14N extract the DNA and use a centrifuge to examine the DNA density If the conservaSve model of replicaSon was correct what …