BIOL 1107 Fall 2024 Practice Exam Unit 2 Replication Name ID 1 Describe at least three different ways that gene expression can be regulated in eukaryotic cells Gene expression can be regulated anywhere along the pathway of the central dogma including transcription such as chromatin structure or transcription factors mRNA processing such as alternative splicing translation such as blocking the process and even after translation such as modifying proteins External signals such as hormones can also regulate gene expression 2 Which eukaryotic structures could be interfered with to prevent translation of mature mRNAs Translation could be interrupted by interfering with the mature mRNAs tRNAs or ribosomes 3 Which of the major molecules involved in gene expression DNA pre mRNA mature mRNA protein would change if a mutation that does not impact splicing occurs in an intron Explain Mutations are permanent changes in DNA and introns are transcribed into pre mRNA so both of those molecules would have different sequences Because the spliceosome removes introns from pre mRNA during processing the mature mRNA and resulting protein would not change 4 A small gene codes for Met Phe Tyr Ile Thr Val Ala but following a single point mutation the product becomes Met Phe Ser Leu Arg What type of point mutation occurred Explain If the changes are due to a single point mutation it had to be a frameshift addition or deletion of nucleotides For example a deletion in the codon for tyrosine would explain these changes 5 If leucine replaces tryptophan as the fifth amino acid in a protein due to a single point mutation in the associated gene can you determine which nucleotide was mutated in the codon Explain Tryptophan has one codon UGG and leucine has six codons UUA UUG CUU CUC CUA and CUG There is only one way for this amino acid substitution to occur by changing a single nucleotide UGG replaced by UUG so the second nucleotide was mutated in the DNA codon 6 Which point mutations that affect the coding regions of genes missense nonsense frameshift silent mutations are the most predictable in terms of their impact on protein function Explain Silent mutations are the most predictable since the resulting protein does not change Nonsense and frameshift mutations usually result in a nonfunctional protein unless only the amino acids at the end of a protein are affected Missense mutations are the least predictable since changing one amino acid for another could have negative neutral or positive effects on protein function 7 Which genetic code property creates the possibility of frameshift mutations in genes Explain Frameshift mutations are caused by an addition or deletion of nucleotides in the coding region of a gene Such a change would only impact a few amino acids if codons overlapped with each other but because the genetic code is nonoverlapping the result is a shift in the reading frame BIOL 1107 Fall 2024 8 Determine which replication enzyme was not functional at each replication fork shown below Unit 2 Replication Practice Exam helicase 9 Which of the major replication enzymes DNA polymerase helicase primase topoisomerase DNA ligase telomerase is not required to replicate the circular DNA of prokaryotes Explain DNA polymerase DNA ligase primase Replication is a very similar process in prokaryotes and eukaryotes but because circular DNA has no ends telomerase is not required to finish replicating the lagging strands in prokaryotes 10 If a nonradioactive DNA molecule is replicated three times when only radioactive nucleotides are available how many of the eight DNA molecules will contain nonradioactive nucleotides Replication is semiconservative strands separate and are used as templates to make complementary strands After three replications two DNA molecules will have original nucleotides that are nonradioactive black in the picture 11 Four replication bubbles form in the circular DNA of a bacterium and a replication fork moves 450 base pairs per second How long would it take to replicate 5 4 million base pairs of DNA There are eight replication forks in this case so the time calculation would be 5 400 000 bp 8 x 450 bp per second 60 seconds per minute 25 minutes 12 Explain why the replication enzymes other than DNA Taq polymerase are not used for PCR primase Primers are DNA rather than RNA and are designed for PCR telomerase PCR does not have lagging strands produced in fragments topoisomerase Heat can separate the DNA strands without unwinding DNA ligase Primers are DNA instead of RNA and cannot be removed helicase Heat is used to separate the DNA strands without unwinding 13 If you perform a polymerase chain reaction PCR on the DNA shown below using the primers 5 GATAC 3 and 5 CGCTA 3 you would produce up to a billion copies of what product 5 GTCCTACGTCACAGTGATACTAGTAGCGTC 3 3 CAGGATGCAGTGTCACTATGATCATCGCAG 5 PCR amplifies target regions bracketed by the two primers which are included in the product BIOL 1107 Fall 2024 Practice Exam Unit 2 Replication Name ID 1 Describe at least three different ways that gene expression can be regulated in eukaryotic cells Explain or provide examples for each 2 Which eukaryotic structures could be interfered with to prevent translation of mature mRNAs 3 Which of the major molecules involved in gene expression DNA pre mRNA mature mRNA protein would change if a mutation that does not impact splicing occurs in an intron Explain 4 A small gene codes for Met Phe Tyr Ile Thr Val Ala but following a single point mutation the product becomes Met Phe Ser Leu Arg What type of point mutation occurred Explain 5 If leucine replaces tryptophan as the fifth amino acid in a protein due to a single point mutation in the associated gene can you determine which nucleotide was mutated in the codon Explain 6 Which point mutations that affect the coding regions of genes missense nonsense frameshift silent mutations are the most predictable in terms of their impact on protein function Explain 7 Which genetic code property creates the possibility of frameshift mutations in genes Explain BIOL 1107 Fall 2024 8 Determine which replication enzyme was not functional at each replication fork shown below Unit 2 Replication Practice Exam 9 Which of the major replication enzymes DNA polymerase helicase primase topoisomerase DNA ligase telomerase is not required to replicate the circular DNA of prokaryotes Explain 10 If a nonradioactive DNA molecule is replicated three times when only radioactive