Recombinant DNA IRecombinant DNA TechnologyDNA pieces are joined in vitro to form recombinant moleculesRestriction endonucleases generate ends that facilitate mixing and matchingDNA ligase covalently joins two DNA moleculesAlternate method to join DNA: homopolymer tailsAlternate method to join DNA: linkersIntroduction of recombinant DNA into living cells via vectorsPlasmid vectorsA common plasmid cloning vector: pUCTransformation of E. coliPhage vectorsYAC vectors for cloning large DNA insertsBacterial artificial chromosomesBAC vectors for large DNA insertsPCR provides access to specific DNA segmentsPolymerase chain reaction, cycle 1Polymerase chain reaction, cycle 2PCR, cycle 3PCR, cycle 4: exponential increase in productPCR, cycle 5: exponential increase in productPCR: make large amounts of a particular sequencePCR is one of the most widely used molecular tools in biologyRecombinant DNA IBasics of molecular cloning Polymerase chain reaction cDNA clones and screeningRecombinant DNA Technology•Utilizes microbiological selection and screening procedures to isolate a gene that represents as little as 1 part in a million of the genetic material in an organism. •DNA from the organism of interest is divided into small pieces that are then placed into individual cells (usually bacterial). •These can then be separated as individual colonies on plates, and they can be screened to find the gene of interest. •This process is also called molecular cloning.DNA pieces are joined in vitro to form recombinant molecules•Generate sticky ends on the DNA, e.g. with restriction endonucleases•Tie DNA molecules from different sources together with DNA ligaseRestriction endonucleases generate ends that facilitate mixing and matchingGAATTCCTTAAGGAATTCCTTAAGGCTTAAAATTC GGCTTAAAATTC GEcoRI cutMix and ligateGCTTAAAATTC GGCTTAAAATTC GRecombinant moleculesGAATTCCTTAAGGAATTCCTTAAGParental moleculesDNA ligase covalently joins two DNA molecules•Uses ATP or NADH to provide energy to seal nicksPPPPPPPPPPPPPPPPPPPPPPAGGAATTCGTATCCTTAAGCATOHOHnicknickPPPPPPPPPPPPPPPPPPPPPPAGGAATTCGTATCCTTAAGCATT4 DNA ligase + ATPAlternate method to join DNA: homopolymer tailsAlternate method to join DNA: linkersIntroduction of recombinant DNA into living cells via vectors•Autonomously replicating DNA molecules– (have an origin of replication)•Selectable marker, such as drug resistance•Insertion site for foreign DNA–(often a genetically engineered multiple cloning region with sites for several restriction enzymes)Plasmid vectors•Circular, extrachromosomal, autonomously replicating DNA molecules•Frequently carry drug resistance genes•Can be present in MANY copies in the cellA common plasmid cloning vector: pUCColE1 originof replicationlacZmulitplecloning sitesApRpUCColE1 orilacZApRpUC recombinantLac+, or blue colonieson X-gal in appropriatestrains of E. coliLac-, or white colonieson X-gal in appropriatestrains of E. coliforeign DNAHigh copy numberTransformation of E. coli•E. coli does NOT have a natural system to take up DNA•Treat with inorganic salts to destabilize cell wall and cell membrane•During a brief heat shock, some of the bacteria takes up a plasmid molecule•Can also use electroporationPhage vectors•More efficient introduction of DNA into bacteria•Lambda phage and P1 phage can carry large fragments of DNA–20 kb for lambda–70 to 300 kb for P1•M13 phage vectors can be used to generate single-stranded DNAYAC vectors for cloning large DNA insertsCEN4oriURA3TEL TELTRP1CEN4oriSUP4TRP1URA3TEL TELpYAC3BBSCut with restrictionEnzymes S + BLigate to very largeFragments of genomicDNALarge insert, 400 to as much as 1400 kb11.4 kbYeast artificial chromosome = YACNot to scale.Bacterial artificial chromosomes•Are derived from the fertility factor, or F-factor, of E. coli•Can carry large inserts of foreign DNA, up to 300 kb•Are low-copy number plasmids•Are less prone to insert instability than YACs•Have fewer chimeric inserts (more than one DNA fragment) than YACs•Extensively used in genome projectsBAC vectors for large DNA insertsCut with restriction enzyme E, remove “stuffer”Ligate to very large fragments of genomic DNASacBIIpromoteroriFCm(R)pBACe3.6EES11.5 kbSacB+: SacBII encodes levansucrase, which converts sucrose to levan, a compound toxic to the bacteria.Large insert, 300kboriFCm(R)promoterSSacBIISacB-: No toxic levan produced on sucrosemedia: positive selection for recombinants.Not to scale.PCR provides access to specific DNA segments•Polymerase Chain Reaction•Requires knowledge of the DNA sequence in the region of interest.•As more sequence information becomes available, the uses of PCR expand.•With appropriate primers, one can amplify the desired region from even miniscule amounts of DNA.•Not limited by the distribution of restriction endonuclease cleavage sites.Polymerase chain reaction, cycle 1Primer 1Primer 2Template1. Denature2. Anneal primers3. Synthesize new DNA with polymeraseCycle 1Polymerase chain reaction, cycle 21. Denature2. Anneal primers3. Synthesize new DNA with polymeraseCycle 2PCR, cycle 31. Denature2. Anneal primers3. Synthesize new DNA with polymeraseCycle 3 (focus on DNA segments bounded by primers)2 duplex molecules of desired productPCR, cycle 4: exponential increase in productCycle 4: Denature, anneal primers, and synthesize new DNA:6 duplex molecules of desired productPCR, cycle 5: exponential increase in productCycle 5: Denature, anneal primers, and synthesize new DNA:14 duplex molecules of desired productPCR: make large amounts of a particular sequence•The number of molecules of the DNA fragment between the primers increases about 2-fold with each cycle.•For n = number of cycles, the amplification is approximately [2exp(n-1)]-2.•After 21 cycles, the fragment has been amplified about a million-fold.•E.g. a sample with 0.1 pg of the target fragment can be amplified to 0.1 microgramPCR is one of the most widely used molecular tools in biology•Molecular genetics - obtain a specific DNA fragment–Test for function, expression, structure, etc.•Enzymology - place fragment encoding a particular region of a protein in an expression vector•Population genetics - examine polymorphisms in a population•Forensics - test whether suspect’s DNA matches DNA extracted from evidence at crime scene•Etc,