Elongation and Termination of TranscriptionElongation phase of transcriptionProteins implicated in elongationModel for RNA Polymerase II PhosphorylationThe shift from initiation to elongation can be a regulated event.Phosphorylated form of RNA PolII is at sites of elongation after heat shockRegulation of HIV transcription at elongationMechanism of regulation at elongation for HIV: TFIIHMechanism of regulation at elongation for HIV: P-TEFbAn in vitro transcription elongation assay shows that both P-TEFb and Tat are needed for elongationHIV regulation via elongation : SummaryElongation factor-dependent realignment of the 3’ RNA endTermination of transcriptionTermination of transcription in E. coli: Rho-independent siteTermination of transcription in E. coli: Rho-dependent siteRho factor, or rModel for action of rho factormRNA Structure in Bacteria : Coupling Transcription Termination and TranslationTranslation can occur simultaneously with transcription in bacteriaPolarityDiagram of polar effectsModel for involve-ment of rho in polar effects of nonsense mutationsEukaryotic mRNA structureElongation and Termination of TranscriptionElongation phase of transcription•Requires the release of RNA polymerase from the initiation complex•Highly processive•Dissociation of factors needed specifically at initiation. –Bacterial  dissociates from the holoenzyme–Eukaryotic TFIID and TFIIA appear to stay behind at the promoter after polymerase and other factors leave the initiation complexProteins implicated in elongation•P-TEFb–Positive transcription elongation factor b–Cyclin-dependent kinase–Phosphorylates CTD of large subunit, Pol II•E. coli GreA and GreB, eukaryotic TFIIS–may overcome pausing by the polymerase–induce cleavage of the new transcript, followed by release of the 3’ terminal RNA fragment. •E. coli NusG, yeast Spt5, human DSIF–Regulated elongation (negative and positive), direct contact with polymerase and nascent transcript•ELL: increase elongation rate of RNA Pol II•CSB: Cockayne syndrome B protein, incr. elongation rateModel for RNA Polymerase II PhosphorylationEukaryotic RNA polymerase IICTD of large subunit of Pol IIPol IIaCTD of large subunit of Pol IIPPPPPPPol IIokinase + ATPphosphataseModel: Phosphorylation of Pol IIa to make Pol IIo is needed to release the polymerase from the initiation complex and allow it to start elongation.CTD has repeat of (YSPTSPT)26-50The shift from initiation to elongation can be a regulated event.•Release from pausing can be the mechanism for induction of expression.–In Drosophila, the RNA polymerase can pause after synthesizing ~ 25 nucleotides of RNA in many genes.–under elevated temperature conditions, the heat shock factor stimulates elongation by release from pausing.–Other possible examples: mammalian c-myc, HIV LTR•This is in addition to regulation at initiation.Phosphorylated form of RNA PolII is at sites of elongation after heat shockImmunofluorescence Detection of Pol II on Drosophila Polytene Chromosomes.Green: dephosphorylatedRed: hyperphosphorylatedYellow: mixedRegulation of HIV transcription at elongation•The human immunodeficiency virus, HIV, is the presumptive cause of AIDS.•It has an enhancer and a promoter in its long terminal repeat, or LTR.•RNA polymerase II pauses at about +70 (within the LTR).•The virally encoded protein Tat is needed to allow elongation past +70.•Tat binds to an RNA structure centered at about +60, called tar.Mechanism of regulation at elongation for HIV: TFIIH•Elongation requires the CTD of RNA Pol II•Tat leads to phosphorylation of RNA Pol II CTD•The kinase in the CDK7 subunit of TFIIH can be used to phosphorylate the CTD of RNA Pol II•An inhibitor of CDK7 will block Tat-dependent elongation by RNA Pol IIMechanism of regulation at elongation for HIV: P-TEFb•Further phosphorylation of CTD of RNA Pol II is catalyzed by the elongation factor P-TEFb, a cellular enzyme.•The kinase subunit of P-TEFb is CDK9.•P-TEFb is needed for elongation past tar in an in vitro assay.•>100,000 compounds were screened for the ability to block Tat-stimulated transcription of HIV, and all the positive compounds were found to inhibit P-TEFb.An in vitro transcription elongation assay shows that both P-TEFb and Tat are needed for elongation70 ntsHela nuclear extract:TatLane_123456789101112700 ntsTranscripts from HIV LTRTatTat__completedepleted of P-TEFbLTR template:encodes TARTAR deletedencodes TARPaused product = 70 ntsElongated product = 700 ntsRemoval of P-TEFb prevents elongationHIV regulation via elongation : Summary•Tat-dependent activation works through both kinases to phosphorylate the Pol II CTD.–TFIIH - perhaps for promoter clearance–P-TEFb - for full elongation•HIV LTR is also regulated at initiation by a large number of transcription factors that bind upstream of the core promoter, all within the LTR.Elongation factor-dependent realignment of the 3’ RNA endElongation factor-dependent realignment of the 3’ RNA end.Backward tran s locationGre or TFIIS-induced cleavage realigns the 3' end with the catalytic site so elongation can resume.Termination of transcriptionTermination of transcription in E. coli: Rho-independent siteGUUAGAGUAGUAGGCCUUGACAAGCCCUAACGA5' ...CCGGAUAACGUUUCGGGAUUUUUU...3'G+C rich region in stemRun of U's 3' to stem-loopTermination of transcription in E. coli: Rho-dependent site5' ...AUCGCUACCUCAUAUCCGCACCUCCUCAAACGCUACCUCGACCAGAAAGGCGUCUCUUTermination occurs at one of these 3 nucleotides.• Little sequence specificity: rich in C, poor in G.• Requires action of rho ( ) in vitro and in vivo.• Many (most?) genes in E. coli have rho-dependent terminators.Rho factor, or •Rho is a hexamer, subunit size is 46 kDa•Is an RNA-dependent ATPase•Is an essential gene in E. coli•Rho binds to protein-free RNA and moves along it (tracks)•Upon reaching a paused RNA polymerase, it causes the polymerase to dissociate and unwinds the RNA-DNA duplex, using ATP hydrolysis. This terminates transcription.Model for action of rho factorαββ'αρ-dependent siteStructure in RNA that causes pausingρ hexamer binds to protein-free RNA and moves along it.RNA polymerase pauses at the ρ-dependent terminator site, and ρ catches upρ unwinds the RNA-DNA hybrid and transcription terminatesRNA polymerase transcribes along the template, and ρ moves along the RNA.ρmRNA Structure in Bacteria : Coupling Transcription