How many genes Mapping mouse traits Lecture 1 Statistics 246 January 20 2004 1 Aim of today s and Thursday s lecture To review basic Mendelian genetics the basics of recombination and go on to see how genes contributing to qualitative and quantitative traits are mapped using data from crosses of inbred strains of mice 2 2 1 Genetic background 2 1 Loci and markers We need to know the following notions from Meldelian genetics autosomes sex chromosomes genotypes phenotypes loci alleles homozygous heterozygous dominant recessive fully inbred markers 3 Our markers are Microsatellites AGTCCACACACACACACATGT AGTCCACACACACACACATGT A PCR and electrophoresis AGTCCACACACACACACATGT AGTCCACACACACACACACACACATGT H AGTCCACACACACACACACACACATGT AGTCCACACACACACACACACACATGT Desirable to call the genotypes A H or B automatically Problems stutters and noise variability of the patterns etc B 4 Similarity Sorting unsorted sorted correlation matrix This is a useful technique to enhance presentation of gel traces and assist manual examination 5 Genotype Calling This is a statistical pattern recognition problem Fit mixture models Discriminant analysis A H B 6 JnoTyper software implementation in Java 7 2 2 Inbred strains and their crosses Our main players are the C57BL 6 BL for black abbreviated B6 a robust strain that has been around about 90 years and the NOD non obese diabetic mouse strain a delicate diabetes prone strain discovered in 1990 Coat colours agouti is standard B6 is black NOD is albino i e white 8 Normal wild type mouse coat color agouti a grizzled color of fur resulting from the barring of each hair in several alternate dark and light bands 9 Black mouse C57 BL6 strain 10 Albino mouse non obese diabetic NOD strain 11 Coat color loci in mice Four main loci A B C and D Locus A agouti Locus B black Locus C known as Tyr albinism Locus D dilution gene 12 Alleles at the Agouti A locus Ay Lethal dominant yellow Avy Viable yellow Aw White bellied Agouti A Agouti or Wild type At Black and Tan Am mottled agouti a Non agouti ae Extreme non agouti A and a are a dominant recessive allele pair 13 Alleles at the Albino C Locus C full color gene cch chincilla ch himalayan c albino gene C and c are a dominant recessive pair of alleles 14 Alleles at A and C interact called epistasis in genetics If the mouse is aaCx it is not agouti and not albino in our case a black mouse If the mouse is AxCx it is agouti and not albino If the mouse is xxcc it is albino no matter what the alleles at the agouti locus are because they are irrelevant 15 Crosses We will denote the NOD mice by A and the B6 mice by B This same notation will denote the two homozygotes at a polymorphic marker Two main crosses interest us following the first filial generation or F1 which we denote by A B H Here H denotes heterozygote which is the case for our F1s The backcross BC is arrived at via H B BC or a variant while the F2 intercross is given by H H F2 16 2 3 Data An F2 inter cross was performed starting with C57BL 6 and NOD parental lines We have 133 female mice at the F2 generation just females for the reason that males fight and this influences other quantitative blood phenotypes of interest They were genotyped at 153 microsatellite markers spanning all 19 autosomes and the X chromosome We also have coat color and a few white blood cell phenotypes 17 A small portion of the data beginning individuals loci traits marker next column data from mouse1 data type f2 intercross 133 153 7 D10M106 BBABBBBBHBBABBBBAABBBB BABAB D10M14 AHHBHHHAHHABAHBHHBABAA BHHAH D10M163 AHBBHHB HHAB HBH BAHBA BHHAH D10M20 HCBHAHBAHHAHAHBABAHHBH HHHAB data type f2 intercross 133 153 7 D10M106 BBABBBBBHBBABBBBAABBBB BABABABBABBBBBBBBBBBBB BBBBBBABBAAABBBBBBBBB HBABABB ABBBBAB BBBABABBB BBBBBCBCBCBHBBBHCBBHBHHBCBBBBBBBHBHBHCH D10M14 AHHBHHHAHHABAHBHHBABAA BHHAHAAHAHHHHHBAHHHAHHBAHBHABBBHAAHHHHAHBHHH HHHHAHAHAHBHHHAHHABAHHHAHHHAHBHBBHHHAAHAAHHBHHAHAH HBABAHAHBHHAH D10M163 AHBBHHB HHAB HBH BAHBA BHHAHAAHAAHHAHBAHHHHHHHAHBHABBBHAAHBBHAHBBHHBBHBHHHH HBHHHHHAHHAHABH AHHHAHBABBBBAAAHAAHHBHHAHHHBHBAHAHABHHHAH D10M20 HCBHAHBAHHAHAHBABAHHBH HHHABAAHAAABHHBH HAHBHAAHBCABABHAAABBHAHBHHBBBHBHAHH HBHHHABAHHHHAHHBAAHHABHABHBHAAHBHAAHBHAAHBHBHBHHHHABAHAAH D10M106 a marker on chr 10 defined by MIT Incompleteness code C B or H D A or H missing 18 A small portion of the raw data end DXM210 HAAAAHHHAHAAAAAHAH HAHHAHAHHH HH DXM222 HAAHHAA HHAAHAAHHAAAHH HAAHAAHHHH DXM39 HAAAHAA HHAH AAA HAAHH HAAAAHHHHHHA Coat color code trait1 trait2 trait3 trait4 trait5 trait6 trait7 data type f2 intercross 133 153 7 D10M106 BBABBBBBHBBABBBBAABBBB BABABABBABBBBBBBBBBBBB BBBBBBABBAAABBBBBBBBB HBABABB ABBBBAB BBBABABBB BBBBBCBCBCBHBBBHCBBHBHHBCBBBBBBBHBHBHCH D10M14 AHHBHHHAHHABAHBHHBABAA BHHAHAAHAHHHHHBAHHHAHHBAHBHABBBHAAHHHHAHBHHH HHHHAHAHAHBHHHAHHABAHHHAHHHAHBHBBHHHAAHAAHHBHHAHAH HBABAHAHBHHAH D10M163 AHBBHHB HHAB HBH BAHBA BHHAHAAHAAHHAHBAHHHHHHHAHBHABBBHAAHBBHAHBBHHBBHBHHHH HBHHHHHAHHAHABH AHHHAHBABBBBAAAHAAHHBHHAHHHBHBAHAHABHHHAH D10M20 HCBHAHBAHHAHAHBABAHHBH HHHABAAHAAABHHBH HAHBHAAHBCABABHAAABBHAHBHHBBBHBHAHH HBHHHABAHHHHAHHBAAHHABHABHBHAAHBHAAHBHAAHBHBHBHHHHABAHAAH 1123112312221111311111112 8 90472059883773 8 62455170973674 8 45460 WBC traits 16 0508869012649 16 1080453151048 16 1678 16 0138456295845 16 0907244541622 16 1250 13 8887610197039 14 1288603771646 13 9863 7 1066061377273 6 52209279817015 6 633318 19 8 65927129000923 8 41405243249672 8 15861 Snapshot of the genotype data 20 Using the LOD error statistic Based on close recombn events which indicate possible presence of genotyping error Error Detection see later calc genoprob calc errorlod plot errorlod 21 2 4 Mendel s laws for one locus We can and should check Mendel with data from our 133 offspring at each of our 153 loci For example at D7Mit126 we have 24 A 29 B and 67 H genotypes adding to 120 indicating 12 incomplete or missing genotypes What do we expect according to Mendel How would we test whether the data agree with our expectations 22 2 5 Mendel s law for 2 loci Mendel inferred from his data on peas the independent segregation of different factors Here we check that this holds for our two coat color loci but not generally We then go on to understand the more general situation 23 Mating Coat color outcomes in this cross C57 BL6 males Parental lines Black aaBBCC NOD females Albinos AABBcc All Agouti F1 F2 aABBCc Agouti 9 Black 3 Albino 4 We need to check these last proportions following Mendel s 24 reasoning Punnett square depicting
View Full Document
Unlocking...