Unformatted text preview:

PowerPoint PresentationSlide 2Slide 3Slide 4Slide 5Slide 6Slide 7Slide 8Slide 9Slide 10Slide 11Slide 12Slide 13Slide 14Slide 15Slide 16Slide 17Slide 18Slide 19Big Events in April 2003Positional cloning of a gene for a highly penetrant Mendelian disorder is now straightforward – but tracking genetic susceptibility factors for non-Mendelian disorders continues to be vexingFinding genetic variants that contribute to common disease is critically important. Here association (case control) studies have greater power than family linkage studies.Slide 24These three variants could theoretically occur in 8 different haplotypesBut in practice, only two are observedThese three variants are said to be in linkage disequilibriumSlide 28Slide 29A Haplotype Map of Human VariationSlide 31With these resources, it is likely that many of the major contributing genes for diabetes, heart disease, cancer, mental illness, Alzheimer’s disease, Parkinson’s disease, asthma, etc. will be identified within the next 5 – 10 years.Slide 33Slide 34Slide 35Slide 36Slide 37Slide 38Will knowledge of human variation reduce prejudice, or increase it?Slide 40Slide 41Will we succumb to genetic determinism, neglecting the role of the environment, and undervaluing the power of the human spirit and our need for God?Figure 9.15 TD Gelehrter, FS Collins, D Ginsburg.Principles of Medical Genetics. 1997.D I S E A S EF U N C T I O NG E N EM A PD I S E A S EF U N C T I O NG E N EM A PF U N C T I O N A L C L O N I N G P O S I T I O N A L C L O N I N GFigure 9.31 TD Gelehrter, FS Collins, D Ginsburg.Principles of Medical Genetics. 1997.…GAA AAT ATC ATC TTT GGT GTT TCC… Glu Asn Ile Ile Phe Gly Val Ser 504 505 506 507 508 509 510 511DNAPROTEINPOSITIONNORMAL…GAA AAT ATC AT - - - T GGT GTT TCC… Glu Asn Ile Ile Gly Val SerDNAPROTEINCYSTIC FIBROSIShttp://www.genome.govhttp://genome.ucsc.eduPowerTo ThePeople!A SAMPLING OF COOL THINGS ABOUT THE GENOMEHumans have fewer genes than expectedHuman genes make more proteins than those ofother crittersMale mutation rate is twice that of females“Junk” DNA contains the remnants and raw materials for evolutionBig Events in April 2003•50th Anniversary of Watson and Crick•Completion of the sequence of all the human chromosomes•Announcement of bold new research plan for genomicsComparative GenomicsProteomicsFunctional GenomicsFulfilling the Promise of Genomics for Better HealthMedical GenomicsPositional cloning of a gene for a highly penetrant Mendeliandisorder is now straightforward –but tracking genetic susceptibility factors for non-Mendelian disorders continues to be vexingFinding genetic variants that contribute to common disease is critically important. Here association (case control) studies have greater power than family linkage studies. N. Risch and K. Merikangas,Science 273: 1516-1517, 1996Sequence from chromosome 7GAAATAATTAATGTTTTCCTTCCTTCTCCTATTTTGTCCTTTACTTCAATTTATTTATTTATTATTAATATTATTATTTTTTGAGACGGAGTTTCACTCTTGTTGCCAACCTGGAGTGCAGTGGCGTGATCTCAGCTCACTGCACACTCCGCTTTCC/TGGTTTCAAGCGATTCTCCTGCCTCAGCCTCCTGAGTAGCTGGGACTACAGTCACACACCACCACGCCCGGCTAATTTTTGTATTTTTAGTAGAGTTGGGGTTTCACCATGTTGGCCAGACTGGTCTCGAACTCCTGACCTTGTGATCCGCCAGCCTCTGCCTCCCAAAGAGCTGGGATTACAGGCGTGAGCCACCGCGCTCGGCCCTTTGCATCAATTTCTACAGCTTGTTTTCTTTGCCTGGACTTTACAAGTCTTACCTTGTTCTGCCTTCAGATATTTGTGTGGTCTCATTCTGGTGTGCCAGTAGCTAAAAATCCATGATTTGCTCTCATCCCACTCCTGTTGTTCATCTCCTCTTATCTGGGGTCACA/CTATCTCTTCGTGATTGCATTCTGATCCCCAGTACTTAGCATGTGCGTAACAACTCTGCCTCTGCTTTCCCAGGCTGTTGATGGGGTGCTGTTCATGCCTCAGAAAAATGCATTGTAAGTTAAATTATTAAAGATTTTAAATATAGGAAAAAAGTAAGCAAACATAAGGAACAAAAAGGAAAGAACATGTATTCTAATCCATTATTTATTATACAATTAAGAAATTTGGAAACTTTAGATTACACTGCTTTTAGAGATGGAGATGTAGTAAGTCTTTTACTCTTTACAAAATACATGTGTTAGCAATTTTGGGAAGAATAGTAACTCACCCGAACAGTGTAATGTGAATATGTCACTTACTAGAGGAAAGAAGGCACTTGAAAAACATCTCTAAACCGTATAAAAACAATTACATCATAATGATGAAAACCCAAGGAATTTTTTTAGAAAACATTACCAGGGCTAATAACAAAGTAGAGCCACATGTCATTTATCTTCCCTTTGTGTCTGTGTGAGAATTCTAGAGTTATATTTGTACATAGCATGGAAAAATGAGAGGCTAGTTTATCAACTAGTTCATTTTTAAAAGTCTAACACATCCTAGGTATAGGTGAACTGTCCTCCTGCCAATGTATTGCACATTTGTGCCCAGATCCAGCATAGGGTATGTTTGCCATTTACAAACGTTTATGTCTTAAGAGAGGAAATATGAAGAGCAAAACAGTGCATGCTGGAGAGAGAAAGCTGATACAAATATAAATGAAACAATAATTGGAAAAATTGAGAAACTACTCATTTTCTAAATTACTCATGTATTTTCCTAGAATTTAAGTCTTTTAATTTTTGATAAATCCCAATGTGAGACAAGATAAGTATTAGTGATGGTATGAGTAATTAATATCTGTTATATAATATTCATTTTCATAGTGGAAGAAATAAAATAAAGGTTGTGATGATTGTTGATTATTTTTTCTAGAGGGGTTGTCAGGGAAAGAAATTGCTTTTTTTCATTCTCTCTTTCCACTAAGAAAGTTCAACTATTAATTTAGGCACATACAATAATTACTCCATTCTAAAATGCCAAAAAGGTAATTTAAGAGACTTAAAACTGAAAAGTTTAAGATAGTCACACTGAACTATATTAAAAAATCCACAGGGTGGTTGGAACTAGGCCTTATATTAAAGAGGCTAAAAATTGCAATAAGACCACAGGCTTTAAATATGGCTTTAAACTGTGAAAGGTGAAACTAGAATGAATAAAATCCTATAAATTTAAATCAAAAGAAAGAAACAAACTA/GAAATTAAAGTTAATATACAAGAATATGGTGGCCTGGATCTAGTGAACATATAGTAAAGATAAAACAGAATATTTCTGAAAAATCCTGGAAAATCTTTTGGGCTAACCTGAAAACAGTATATTTGAAACTATTTTTAAAThree variants are presentThese three variants could theoretically occur in 8 different haplotypes…C…A…A……C…A…G……C…C…A……C…C…G……T…A…A……T…A…G……T…C…A……T…C…G…But in practice, only two are observed…C…A…A……C…A…G……C…C…A……C…C…G……T…A…A……T…A…G……T…C…A……T…C…G…These three variants are said to be in linkage disequilibrium…C…A…A……C…A…G……C…C…A……C…C…G……T…A…A……T…A…G……T…C…A……T…C…G…~ 30 kbA Haplotype Map of Human Variation•Goal is to define all common haplotypes in the human genome•Genome-wide association studies can then be done with 30 – 50 times less work•Project was initiated in October 2002, using samples of African, Asian, and European originNature, Vol. 418, 426-430, July 25, 2002With these resources, it is likely that many of the major contributing genes for diabetes, heart disease, cancer, mental illness, Alzheimer’s disease, Parkinson’s disease, asthma, etc. will be identified within the next 5 – 10 years.Gleevec™ – Specifically TargetsAn Abnormal Protein, Blocking Its Ability To Cause Chronic Myeloid LeukemiaChromosome 9;22 translocationCMLBcr-Abl fusion proteinGleevec™Bcr-Abl fusion protein NormalEthical, Legal, and Social ImplicationsAn integral component of theHuman Genome ProjectWill effective legislativesolutions to geneticdiscrimination be found?Can health


View Full Document

U-M SI 501 - Lecture 26

Download Lecture 26
Our administrator received your request to download this document. We will send you the file to your email shortly.
Loading Unlocking...
Login

Join to view Lecture 26 and access 3M+ class-specific study document.

or
We will never post anything without your permission.
Don't have an account?
Sign Up

Join to view Lecture 26 2 2 and access 3M+ class-specific study document.

or

By creating an account you agree to our Privacy Policy and Terms Of Use

Already a member?