BIOL 302: Final Exam

CourseStructure object (177733) - University Of South Carolina-Columbia

Study Flashcards

125 Cards in this Set

Front	Back
T/F ATP hydrolysis can drive an energetically unfavorable chemical reaction by transferring a phosphate group to a reactant, thereby allowing a transfer of energy	TRUE
Deamination of cytosine, if uncorrected, results in the ____ when the DNA is replicated with depurination if incorrect can lead to ____ A. Substitution of one base for another; the loss of a nucleotide pair B. The loss of a nucleotide pair; substitution of one base for another…	A. substitution of one base for another; the loss of a nucleotide pair
DNA is synthesized by covalently linking a nucleoside triphosphate to the previous nucleotide constantly adding to a growing chain. The new strand becomes part of a stable double helix. The two strands are complementary in sequence and anti-parallel in directionality. What is the princ…	B. hydrogen bonds
In folded protein, most of the nonpolar amino acids are buried inside the protein fold, whereas the polar and charged side chains are exposed to the components in the cytosol. This fold is more stable b/c of the exclusion of nonpolar atoms form contact w/ water, favoring the interaction …	hydrophobic interaction
What is the letter abbreviation for amino acid glutamine?	Gln
At first glance, it may seem that living systems are able to defy the second law of thermodynamics. However, on closer examination it becomes clear that although cells create organization from raw material in the environment, they also contribute to disorder in the environment by release…	C. heat
The correct folding of proteins is necessary to maintain healthy cells and tissues. Unfolded proteins are responsibility for such neurodegenerative disorders such as Alzheimer’s, Huntington’s, etc. What is the ultimate fate of these disease-causes unfolded proteins?	they form protein aggregates
Which of the following is not a feature commonly observed in beta sheets? A. Antiparallel regions B. Coiled-boil patterns C. Extended polypeptide backbone D. Parallel regions	B. Coiled-boil patterns
Which of the following chemical groups is not used to construct a DNA molecules? A. Five-carbon sugar B. Phosphate C. Nitrogen-containing base D. Six-carbon sugar E. None of the above	D. six-carbon sugar
T/F Hydrogen bonds are non-covalent bonds that are important in maintaining the conformation of proteins	true
T/F Primase is needed to initiation DNA replication on both the leading strand and the lagging strand	true
RNA in cells differs from DNA in that ___	It is single-stranded and con fold up into a variety of structures
A nucleosome core particle contains a core of histone with DNA wrapped around it approximately:	two times
The phosphorylation of a protein is typically associated with a change in activity, the assembly of a proteins complex, or trigger of a downstream signaling cascade. The enzyme that catalyzes the addition of a phosphate group onto a protein is called a _________	kinase
Which of the following statement about the newly synthesized strand of a human chromosome is true? A. It was synthesized from a single origin solely by continuous DNA synthase B. It was synthesized from a single origin by a mixture of continuous and discontinuous DNA synthase …	C. it was synthesized form multiple origins by a mixture of continuous and discontinuous DNA synthase
Which of the following are examples of covalent bonds? A. Peptide and hydrogen B. peptide and phosphodiester C. Hydrogen and phosphodiester D. Hydrogen and ionic	B. peptide and phosphodiester
A loss of protein conformation is referred to as:	denaturation
Which amino acid will be on the tRNA that is the first to bind to the P-site of the ribosome:	methionine
When proteins are formed by interactions between more than one polypeptide chain, they are said to contains:	quaternary structure
T/F homologous recombination is a flawless DNA repair method for double strand breaks while non-homologous end joining is sometimes referred to as the “quick and dirty” method	TRUE
The potential energy stored in high-energy bonds is commonly harnessed when the bonds are split by the addition of __________ in a process called _________ A. ATP, phosphorylation B. Water, hydrolysis C. Hydrolyze, hydration D. Water, condensation	B. Water, hydrolysis
NADH and NADPH are activated carrier molecules that function in metabolic reactions. Both carry two additional ______ and one additional _______. This combination can also be referred to as hydride ion. A. Protons, electrons B. Electrons, phosphate C. Hydrogens, electro…	D. electrons, proton
T/F some intracellular signaling proteins serve to integrate incoming signals. In these signaling pathways, the cellular response is only achieved when both signals are simultaneously present	true
The Ras proteins is a GTPase that functions in many growth-factor signaling pathways. In its active form, with GTP bound, it transmits a downstream signal that leads to cell proliferation; in it inactive form, with GDP bound the signal is not transmitted. Mutations in the gene for Ras ar…	D. a change that decreases the rate of hydrolysis of GTP by Ras
T/F endocrine and paracrine style signaling pathways re two types of long range communication methods used by cells	FALSE
Most proteins destined to enter the ER:	Begin to cross the membrane while still being synthesized
The address information for protein sorting in a eukaryotic cell is contained in the _____ of proteins. Proteins enter the nucleus in their _____ form. Proteins that remain in the cytosol do not contain a ______ the proteins transported into the ER by ______ are in their ______ form.	AA SEQUENCE FOLDED SORTING SIGNAL PROTEINS TRANSLOCATORS UNFOLDED
Which of the following protein families are not involved in directing transport vesicles to the target membranes? A. Snares B. Rabs C. Tethering proteins D. Adaptins	D. Adaptins
The hydrolysis of GTP to GDP carried out by tubulin molecules: A. allows the behavior of microtubules called dynamic instability B. Provides the energy needed for tubulin to polymerize C. Occurs b/c the pool of free GDP has run out D. Tips the balance in favor of m…	A. allows the behavior of microtubules called dynamic insstability
Your friend has just joined a lab that studies vesicle budding form the Golgi and has been given a cell line that does not form mature vesicles. He wants to start designing some experiments but wasn’t listening carefully when he was told about the molecular defect of this cell line. He’…	C. dynamin
Which of the following statements about cytoskeleton is true? A. The cytoskeleton provides a right and unchangeable structure of the cell B. The three cytoskeletal filaments never associate with each other in the cell and act completely independently of one another C. ac…	C. actin filaments and microtubules have an inherent polarity, with a plus end that grows more quickly than the minus end
T/F in secretory cells, the regulated and constitutive pathways of exocytosis diverge in the Trans Golgi network. A consecutive secretory pathways is one that operates only when an extracellular signal stimulates their secretion	FALSE
Microtubules are important for transporting cargo in nerve cell axons. Notice that the two types of cargo are traveling in opposite directions. Which of the following statements is likely to be false? A. The gray cargo is attached to dynein B. The black cargo and gray cargo …	D. The black cargo and the gray cargo are moving along microtubules of opposite polarity
Which of the following statement about the UPR is true? A. Misfolded proteins bind to receptors that stimulate the production of a transcription regulator B. Activation of the UPR results in the production of more chaperone proteins C. Activation of the UPR occurs when r…	E. all of the above
T/F when studying signal transduction pathways in a laboratory-based stetting, mutant transmembrane protein receptors can be synthesis zed to help determine exactly where an intercellular signaling molecule binds	true
Which of the following choices reflects the appropriate order through which a protein is destined for the PM travels? A. Lysosome -> endosome -> PM B. ER -> lysosome -> PM C. Golgi -> lysosome -> PM D. ER -> Golgi -> PM	D. ER -> Golgi -> PM
Acetylcholine binds to a GPCR on heart muscle, making the heart beat more slowly. The activated receptor stimulates a G protein, which opens a K+ channels in the PM. Which of the following would enhance this effect of acetylcholine? A. Addition of a high concentration of a non-hyd…	A. addition of a high concentration of a non-hydrolysable along of GTP
Which of the following statement about the ER is false? A. The ER is the major site for new membrane synthesis in the cell B. Proteins to be delivered to the ER lumen are synthesized on smooth ER C. The ER membrane is continuous with the outer nuclear membrane	B. Proteins to be delivered to the ER lumen are synthesized on smooth ER
Which of the following structures are not important for flagellar movement? A. sarcoplasmic reticulum B. ATP C. Dynein D. Microtubules	A. sarcoplasmic reticulum
Which of the following statement is true? A. Nucleation of new filaments at the leading edge pushes the PM forward B. ARP proteins nucleate the branched actin filaments in the lamella C. Capping proteins bind to the plus end of active filaments D. There is more ATP…	E. all of the above
N-linked oligosaccharides on secreted glycoproteins are attached to _______	the NH2 of an asparagine residue in the growing polypeptide chain
While performing your lab research you examine a cell in with a constitutively active Ras protein. Which of the following conditions will turn off signaling in the cell line? A. Addition of drug that prevents protein X from activation Ras B. Addition of drug that increases th…	C. Addition of drug that blocks protein Y from interacting with its target
Indicate which of the three major classes of cytoskeletal elements refers to: a. Monomer that binds to ATP: _____ b. Includes keratin and neurofilaments:______ c. Can be connected through desmosomes: ______ d. Used in the eukaryotic cilia:______	a. actin b. intermediate filament c. intermediate filaments d. microtubules
Which of the following structures shorted during muscles contraction? A. Myosin filament B. Flagella C. Sarcomeres D. Actin filaments	C. Sarcomeres
What is the role of the nuclear localization sequence in a nuclear protein? A. It is bound by cytoplasmic nuclear receptor proteins that direct the nuclear protein to the nuclear pore B. It is a hydrophobic sequence that enables the protein to enter the nuclear membrane C. …	A. It is bound by cytoplasmic nuclear receptor proteins that direct the nuclear protein to the nuclear pore
T/F the microtubule based cytoskeleton in flagella is called the axoneme	TRUE
Which of the following happens when a cell-surface receptor activates a G protein? A. The beta subunit exchanges its bound GDP for GTP B. The GDP bound to the alpha subunit is phosphorylated to form bound GTP C. The alpha subunit exchanges its bound GDP for GTP D. …	C. The alpha subunit exchanges its bound GDP for GTP
Cell movement involves the coordination of many events in the cell. Which of the following phenomena are not required for cell motility? A. Myosin II mediated contraction at the rear of the moving cell B. New points of anchorage between the leading edges of the cell and subst…	D. Releases of calcium from the SR
Which of the following statements about skeletal muscle contraction is true? a. When a muscle cell receives from the nervous system, voltage-gated channels open in the T-tubule membrane b. The changes in voltage across the PM that occur when a muscle cell receives a signal for…	E. all of the above
Which of the following statements concerning the ER signal sequence and/or the SRP is true? a. The SRP binds to the exposed ER signal sequence and to the ribosome, thereby slowing protein synthesis by the ribosome b. The SRP-ribosome complex bind to an SRP receptor in the ER m…	D. all of the above
Identify the membrane enclosed compartments in a eukaryotic cell where each of the functions listed below take place: a. Oxidative phosphorylation: ________ b. Modification of secreted proteins: ______ c. Steroid hormone synthesis: _____ d. Degradation of worn-out …	a. mitochondria b. Golgi apparatus c. smooth ER d. lysosomes
Cells can signal to each other in various ways. A signal that must be relayed to the entire body is most efficiently sent by _______ cells, which produce hormones that are carried throughout the body through the bloodstream. Conversely, _____ methods of cell signaling do not require the…	ENDOCRINE CONTACT-DEPENDENT PARACRINE NEURONAL RECEPTOR
N-linked oligosaccharides on secreted glycoproteins are attached to a. The cytosolic face of the ER b. The serine or threonine residue in the growing polypeptide chain c. The NH2 of an asparagine residue in the growing polypeptide chain d. None of the above	c. The NH2 of an asparagine residue in the growing polypeptide chain
Which amino acid is represented by the abbreviation Asn?	asparagine
How many different amino acids are used in making proteins?	20
An element may have more than one isotope. Isotopes have different atomic weights, but exhibit the same chemical behavior. Carbon-14 is an unstable isotope of carbon that decays very slowly. Compared to the common, stable carbon-12 isotope, carbon-14 has two addition________ a. E…	b. neutrons
Chemical reactions carried out by living systems depend on the ability of some organisms to capture and use atoms from nonliving sources in the environment. The specific subset of these reactions that breakdown nutrients in food can be described as ___________	catabolic
A nucleosome contains two molecules each of histones ________	H2A, H2B, H3, H4
DNA replication is considered semiconservative b/c ___________	EACH DAUGHTER DNA MOLECULE CONSISTS OF ONE STRAND FROM THE PARENT DNA MOLECULE AND ONE NEW STRAND
Transcription in bacteria differs from transcription in eukaryotic cell b/c: a. RNA polymerase (along with its sigma subunit) can initiate transcription on its own b. RNA polymerase (along with its sigma subunit) requires the general transcription factors to assemble at the pr…	a. RNA polymerase (along with its sigma subunit) can initiate transcription on its own
A loss of protein conformation is to as _____	denaturation
You have a segment of DNA that contains the following sequence: 5’ –GGACTAGACAATAGGGACCTAGAGAGTTCCGAAA-3’ 3’ –CCTGATCTGTTATCCCTGGATCTCTAAGGCTTT -5’ if you know that the rna transcribed from this segment contains the following sequence: 5…	a. The bottom strand is the template strand; RNA polymerase moves along this strand from 3’ to 5’
Which of the following statements is true a. A ribosome is large complex of four RNAs and more than 80 proteins b. A ribosome has a binding site of mRNA and three binding sites for tRNA c. rRNA contains the catalytic activity that joins amino acids together d. A ri…	e. all of the above
Besides the distortion in the DNA backbone caused by a mistmatched base pair, what additional mark may also be found in eukaryotic DNA to indicate which strand needs to be repaired? a. A nick in the template strand b. A chemical modification of the new strand c. A nick i…	c. A nick in the new strand
T/F Francis Crick, James Watson. Maurice Wilkins, and Rosalind Franklin were awarded the Nobel Prize in Medicine in 1962 for discoveries of the structure of DNA and its significance for information transfer in living organisms	FALSE
Pyruvate is an important metabolic intermediate that can be converted into several other compounds, depending on which enzyme is catalyzing the reaction. Which of the following can be produced from pyruvate in a single enzyme-catalyzed reaction? a. Lactate b. Oxaloacetate c.…	d. all of the above
T/F Photobleaching techniques, such as FRAP, can be used to measure the rate of lateral diffusion of a membrane protein	TRUE
The tryptophan operator ________ a. Is an allosteric protein b. Binds to the tryptophan repressor when the repressor is bound to tryptophan c. Is required for production of the mRNA encoded by the tryptophan operon d. Is important for the production of the tryptoph…	b. Binds to the tryptophan repressor when the repressor is bound to tryptophan
Pumps are transporters that are able to harness energy provided by other components in the cells to drive the movement of solutes across the membrane, against their concentration gradients. This type of transport is called ________ a. Active transport b. Free diffusion c. …	a. active transport
Which of the following methods is not used by cells to regulate the amount of a protein in the cell? a. Genes can be transcribed into mRNA with different efficiencies b. Many ribosomes can bind to a single mRNA molecule c. Proteins can be tagged with ubiquitin, marking t…	d. Nuclear pore complexes can regulate the speed at which newly synthesized proteins are exported form the nucleus into the cytoplasm
There are two properties of phospholipids that affect how tightly they pack together: the length of hydrocarbon chain and the number of double bonds. The degree of packing, in turn, influences the relative mobility of these molecules in the membrane. Which of the following would yield t…	b. 15 carbons w/ 2 double bonds
Final ATP yield per molecules of glucose: a. Glycolysis: 2 NADH -> _____ b. Pyruvate oxidation to acetyl CoA (two per glucose): 2 NADH -> _____ c. Complete acetyl CoA oxidation (two per glucose): 6 NADH -> _____ d. Total: _____	a. 3 ATP b. 5 ATP c. 15 ATP d. 30 ATP
Plasma membrane are extremely thin and fragile, requiring an extensive support network of fibrous proteins. This network is called the _______ a. Cell cortex b. Attachment complex c. Transmembrane proteins d. Spectrin	a. cell cortex
T/F: The enzyme that catalyzes the last irreversible reaction in glycolysis (step 10), yielding a molecule of ATP and pyruvate, is called a hexokinase.	FALSE
What type of defect is most likely to cause the redistribution of the protein around the entire cell? a. A nonfunctional protein glycosylate b. The deletion of a junctional protein c. The truncation of a protein found in the extracellular matrix d. A nonfunctional …	b. the deletion of a junctional protein
Which component of the ETC is required to combine the electrons with molecular oxygen? a. Cytocrhome c b. Cytochorme b-c1 complex c. Ubiquinone d. Cytochrome oxidase	d. cytochrome oxidase
The human genome encodes about 24,000 genes. Approximately how many genes does the typical differentiated human cell express at any one time? a. 24,000- all of them b. Between 21,500 and 24, 000 – at least 90% of the genes c. Between 5,000 and 15,000 d. Less than …	c. between 5,000 and 15,000
Combinatorial control of gene expression ____________ a. Involves every gene using a different combination of transcriptional regulators for its proper expression b. Involves groups of transcriptional regulators working together to determine the expression of a gene c. I…	b. Involves groups of transcriptional regulators working together to determine the expression of a gene
The drug dinitrophenol (DNP) makes the inner mitochondrial membrane permeable to H+ ions. Therefore, when added to mitochondria, DNP a. Will decrease the production of ATP b. Will decrease the pH gradient across the membrane c. Will cause electron pump activity to stop …	d. Will decrease both the production of ATP and the pH gradient across the membrane
Which of the following is not involved in post-transcriptional control? a. The spliceosome b. Dicer c. Mediator d. RISC	c. mediator
T/F Inside the mitochondrial matrix, one molecule of FADH2 will yield just as much of an ATP equivalent as one molecule of NADH	FALSE
Operons_________ a. Are commonly found in eukaryotic cells b. Are transcribed by RNA polymerase II c. Contain a cluster of genes transcribed as single mRNA Can only be regulated by gene activator proteins	c. Contain a cluster of genes transcribed as single mRNA
The stimulation of auditory nerves depends on the opening and closing of channels in the auditory hair cells. Which type of gating mechanism do these cells use? a. Voltage-gated b. Extracellular ligand-gated c. Intracellular ligand-gated d. Stress-gated	d. Stress-gated
We know the detailed molecular structure and mechanism of action of the transmembrane protein bacteriorhodopsin. This protein uses sunlight as the source of energy to pump ______ out of the cell. a. ATP b. H+ c. K+ d. Na+	b. H+
Although the extracellular environment has a high sodium ion concentration and the intracellular environment has a high potassium ion concentration, both must be neutralized by negatively charged molecules. In the extracellular case, what is the principal anion? a. HCO-3 b. C…	b. Cl-
If Na+ channels are open in a cell that was previously at rest, how will the resting membrane potential be affected? a. The membrane potential is not affected by Na+ b. It becomes more negative c. It becomes more positive d. It is permanently reset	c. it becomes more positive
T/F if the concentration of solutes inside a cell is higher than that outside, water will move in by osmosis, causing the cell to under crenation	FALSE
The distinct characteristics of different cell types in a multicellular organism result mainly from differential regulation of the ________ a. Replication of specific genes b. Transcription of genes transcribed by RNA Polymerase II c. Transcription of housekeeping genes …	b. Transcription of genes transcribed by RNA Polymerase II
T/F: proteins that span the PM can also be referred to as peripheral membrane proteins, while proteins that associate with, but do not transverse the PM, are referred to as integral membrane proteins	FALSE
Which of the following is required for the secretion of neurotransmitters in response to an action potential? a. Neurotransmitter receptors b. Sodium potassium pumps c. Voltage-gated K+ channels d. Voltage-gated Ca2+ channels	d. voltage-gated Ca2+ channels
T/F A mature miRNA assembles with a set of proteins to form a RISC complex. RISC strands for RNA-instructed screening complex	FALSE
Which of the following statements about carbohydrate coating of the cell membrane is false? a. Carbohydrate coatings are not found in the cytosolic side of the membrane b. Carbohydrate coating can play a role in cell-cell adhesion c. Specific oligosaccharides can be invo…	d. none of the above
MicroRNAs _____________ a. Are produced from precursor miRNA transcript b. Can degrade RNAs by using their intrinsic catalytic activity c. Control gene expression by base-pairing with DNA sequences d. None of the above	a. are produced from precursor miRNA transcript
T/F A riboswitch is a short sequence in a number of mRNAs that change their conformation when bund to small molecules to regulate their own transcription and translation	TRUE
Membrane lipids are capable of many different type of movement. Which of these occurs most rarely in biological membranes? a. Flip-flopping between lipid bilayers b. Lateral movement c. Rotation d. Flexing of hydrocarbon chains	a. Flip-flopping between lipid bilayers
The reaction cycle that uses acetyl CoA to general electron carrier molecules needed in ETC is important for powering the cell. Which of the names below is not one of those commonly used to describe this reaction cycle? a. Tricaboxylic acid cycle b. Krebs cycle c. Oxalo…	c. Oxaloacetic acid cycl
T/F a repressor protein binds to a regulatory sequence on the DNA and then interacts with the RNA polymerase to help it initiate transcription	FALSE
One method of establishing cell memory is through the faithful propagation of the DNA methylation patterns on CpG dinucleotides during DNA replication. The enzymes that guarantee that a pattern of DNA methylation is inherited by progeny DNA are ____________ and this process is typically …	b. Maintenance methyltranferases; epigenetic inheritance
DNA replication is confined to _____ phase	S phase
G1 is the gap between ___ and ____	M phase and S phase
G2 is the gap between ______ and ________	S phase and M phase
During M phase, the nucleus divides first, in a process called ___; then the cytoplasm divides in a process called _____	mitosis; cytokinesis
The period between one M phase and the next is called ______	interphase
The checkpoint in G1 determines whether the cell proceeds to ______ The one in G2 determines whether the cell proceeds to _____ The one in M phase determines wether the cell is ready to ______	S phase mitosis pull the duplicated chromosomes apart and segregate them into two daughter cells
The Cdk must bind a regulatory protein called a _____ before it can become enzymatically active	cyclin
After S phase, the sister chromatids are held together by protein complexes called ______	cohesions
When DNA is damaged, specific protein kinases respond by activating the ______	p53 protein
_____ help to coil the mitotic chromatids into smaller, more compact structures for segregation during mitosis	condensins
Cell division occurs in the ____ of the cell cycle	M phase
During _____,the cell increases in size. The DNA of the chromosome is replicated, and the centrosome is duplicated.	interphase
At _____, the replicated chromosomes, each consisting of two closely associated sister chromatids condense.	prophase
During ____ the breakdown of the nuclear envelope occurs.	prometaphase
At _____, the chromosomes are aligned at the equator of the spindle, midway between the spindle poles	metaphase
At _____, the sister chromatids synchronously separate, and each is pulled slowly toward the spindle pole it is attached to.	anaphase
During ____, the two sets of chromsomes arrive at the poles of the spindle.	telophase
During ____ of an animal cell, the cytoplasm is divided in two by a contractile ring of actin and myosin filaments, which pinches in the cell to create two daughters, each with one nucleus.	cytokinesis
The eukaryotic cell cycle consists of _____	S, M, G1, and G2 phases
The control system of the cell cycle depends on a set of kinases, composed of a regularotory subunit, _____, and a catalytic subunit, _____	cyclin; cyclin-dependent protein kinase (Cdk)
the Cdks are activated by both ____ and the ____ of some amino acids and the dephosphorylation of others.	cyclin binding; phsphorylation
M phase consists of _____ and ____	mitosis and cytokinesis
What are the names of the three classes of microtubules that make up the mitotic spindle?	astral microtubules, kinetochore microtubules, interpolar microtubules
The ___ triggers the separation of sister chromatids by promoting the destruction of cohesions	APC (anaphase-promoting complex)
APC catalyzes the ubiquitylation and destruction of an inhibitory protein called _____	securin
The APC activates securin which inhibits the activity of the enzyme ____ which when freed from securin, cleaves the cohesion complexes, allowing the mitotic spindle to pull the sister chromatids apart. The APC targets the ____ for destruction, thus rendering the M-Cdk complex inactive, w…	separase; M cyclin
During anaphase, the two spindle poles move apart as the result of two forces: 1 2	1. the elongation and sliding of the interpolar microtubules past one another 2. forces exerted by outward-pointing astral microtubules


School:
Email:
New Password:
Confirm Password:

BIOL 302: Final Exam

125 Cards in this Set

Popular Documents

Popular Course Packets

Popular Flashcards

Reviews

Access the best Study Guides, Lecture Notes and Practice Exams

Please select your school