Name_______________________________________________ Biol 211 - Group Number________ ALE 10 - Page 1 of 10 Active Learning Exercise 10. From Gene to Protein Reference: Chapter 17 (Biology by Campbell/Reece, 8th ed.) RNA and Transcription 1. How does the DNA inherited by an organism determine the specific traits displayed by that organism? That is, how does the specific order of nucleotides in the DNA inherited by a critter determine its phenotypic characteristics such as eye and hair color, the kind of digestive enzymes produced, whether wings or arms will be produced, etc.? 2. The metabolic pathway to the right, discovered by the British physician A.E. Garrod, ensures that the amino acid tyrosine, derived from the digestion of excess protein, is disposed of metabolically. However, in certain individuals large quantities of homogentistic acid are excreted in the urine, which then turns black on standing. This condition, known as alkaptonuria, runs in families—i.e. it is inherited. Explain the genetic basis for alkaptonuria. 3. Which of the following is the best example of gene expression? a.) A frog adapts to variation in its environmental temperature. b.) Mouse fur color results from pigment formed by gene-encoded enzymes. c.) DNA is replicated during the S phase of the cell cycle. d.) The percent of allele "A" versus the percent of allele "a" in a population is altered by natural selection. e.) Mutation alters the sequence of a region of DNA.ALE 10 - Biology 211 (Revised Fall 2009) ALE 10 - Page 2 of 10 4. Distinguish between Beadle and Tatum’s “one gene—one enzyme hypothesis” (for which they won a Noble Prize in 1958) and the “one gene—one polypeptide hypothesis” and then explain why neither hypothesis is entirely true. 5. Compare and contrast DNA and RNA by completing the following table: DNA RNA Number of strands Type of sugar Nitrogenous bases Cellular Function 6. a.) What is the name of the process that produces RNA? _________________________________ b.) Where does the process occur in the cell? __________________________________________ 7. Looking at the synthesis of messenger RNA..... a.) What enzyme is needed for its creation? __________________________________________ b.) Where on the DNA does this enzyme begin activity?_________________________________ c.) What is the enzyme’s direction of movement on the DNA molecule? ____________________ d.) What prevents this enzyme from working all the way to the end of the DNA molecule? e.) Discuss the roles played in transcription by each of the following… i.) TATA box ii.) Transcription factors iii.) transcription initiation complex?ALE 10 - Biology 211 (Revised Fall 2009) ALE 10 - Page 3 of 10 f. ) After processing of the pre-mRNA molecule to produce a functional mRNA, where does this newly created messenger RNA molecule go next? For what purpose? 8. Explain how RNA is transcribed from DNA by discussing what is happening in each of the three stages in the figure to the right. 9. Enzymes in the nucleus of eukaryotic organisms modify pre-mRNA molecules (also called primary transcripts) before they exit the nucleus for the cytoplasm where they act as a blueprint for protein synthesis. Identify the functions for each of the following post-transcriptional modifications of the primary transcript..... a.) 5’ cap: A modified guanine nucleotide is added as a cap on the 5’ end of the pre-mRNA. b.) Poly(A) tail: 30 to 200 adenine nucleotides are added to the 3’ end of the pre-mRNA . c.) RNA splicing or RNA processing: Introns are removed from the pre-mRNA by spliceosomes and the resulting exons are connected.ALE 10 - Biology 211 (Revised Fall 2009) ALE 10 - Page 4 of 10 10. Eukaryotic cells make pre-mRNA transcripts that are on average about 6 to 7 times longer than required to make the average polypeptide. Thus pre-mRNA molecules require a cut and paste job (RNA splicing) to bring them down to the correct size. Is the presence of introns between the functional exons and RNA splicing energetically wasteful? Of what functional and/or evolutionary importance is RNA splicing and the production of introns? 11. a.) What is meant by the term “Triplet Code”? b.) On what molecule(s) is the triplet code found? ______________________________________ 12. What is the template strand (also known as the “sense strand”)? What role does it play? Peptides and Translation 13. a.) What is a codon? What role do they play? b.) On what molecule are codons found? _____________________ 14. a.) What is an anticodon? What role do they play? b.) On what molecule are anticodons found? ___________________ 15. What is the “Dictionary of the Genetic Code”? 16. Why is it unnecessary to produce a dictionary for anticodons?ALE 10 - Biology 211 (Revised Fall 2009) ALE 10 - Page 5 of 10 17. What is a “reading frame”? Of what importance is the reading frame? 18. A segment of a gene has the base sequence: 5’ AATTTGCCTGGGCATCATAAAGA 3’ a.) What is the base sequence of the complementary strand? Indicate the 5’ and 3’ ends. b.) What experimental evidence supports the sequence in part a? (Hint: Edwin Chargaff) c.) What is the maximum number of amino acids coded for by this segment on DNA? _________ d.) Transcribe the complementary strand. Use letters to show the base sequence of the product below. Indicate the 5’ and 3’ ends. e.) Translate the mRNA produced above into a peptide. Remember that ribosomes read mRNA in only one specific direction. Use three letter abbreviations to show the amino acid sequence below. 19. List in order the sequence of events that take place when a DNA sequence (i.e. gene) is used to direct the synthesis of an enzyme or other polypeptide. Number your steps.ALE 10 - Biology 211 (Revised Fall 2009) ALE 10 - Page 6 of 10 20. On this model of a tRNA molecule, label each of the following: 5′ and 3′ ends hydrogen bonds unpaired regions anticodon loop binding site for amino acid 21. What are the two most important functions of a tRNA molecule? Hints: anticodon/codon, amino acids. 22. Aminoacyl-tRNA synthetase is an enzyme whose function is to attach a molecule of a/an _________________________ to a molecule of __________________________. 23. What is represented at each of the lettered sites and what occurs at