1DNA SEQUENCE DATA-From template DNA to Sequence Alignment…DNA SEQUENCE DATA-From template DNA to Sequence Alignment…Case Study:Western Diamondback Rattlesnake (Crotalus atrox)Case Study:Case Study:Western Diamondback Western Diamondback Rattlesnake (Rattlesnake (CrotalusCrotalusatroxatrox))2ProtocolProtocolProtocol1. Collect tissue samples from C. atroxindividuals and extract tDNA 2. Amplify specific gene using PCR (Polymerase Chain Reaction)3. Sequence PCR products4. Align our sequence with published sequences5. Analyze with phylogenetic software 1.1.Collect tissue samples from Collect tissue samples from C. C. atroxatroxindividuals and extract individuals and extract tDNA tDNA 2.2.Amplify specific gene using PCR Amplify specific gene using PCR (Polymerase Chain Reaction)(Polymerase Chain Reaction)3.3.Sequence PCR productsSequence PCR products4.4.Align our sequence with published Align our sequence with published sequencessequences5.5.Analyze with phylogenetic software Analyze with phylogenetic software PCR – PurposePCR PCR ––PurposePurpose• Need multiple copies of the gene in order to sequence it• Primer extension reaction for amplification of specific nucleic acids in vitro••Need multiple copies Need multiple copies of the gene in order to of the gene in order to sequence itsequence it••Primer extension Primer extension reaction for reaction for amplification of amplification of specific nucleic acids specific nucleic acids in vitroin vitro3PCR – Reaction CompositionPCR PCR ––Reaction Reaction CompositionComposition• tDNA• Sequence specific primers• dNTP’s• Taq polymerase• Buffer• Thermocycler ••tDNAtDNA••Sequence specific primersSequence specific primers••dNTP’sdNTP’s••TaqTaqpolymerasepolymerase••BufferBuffer••Thermocycler Thermocycler45PCR – How do we know it worked?PCR PCR ––How do we know it How do we know it worked?worked?6DNA SequencingDNADNASequencingSequencingTo this!To this!To this!TATCCGCATAATACAGATCCTCCCCACAACAAAAACCGACCTATTCCTTCCATTCATCAT TCTAGCCCTCTGAGGGGCAATTCTAGCCAATCTCACATGCCTACAACAGACAGACCTAAA ATCCCTAATCGCCTACTCCTCCATCAGCCACATAGGCCTAGTAGTAGCCGCAATTATTAT CCAAACCCCATGAGGCCTATCCGGAGCCATAGCTCTAATAATCGCACACGGATTTACCTC CTCAGCACTCTTCTGCCTAGCTAACACAACCTATGAACGAACACACACCCGAGTCCTAAT TCTTACACGAGGATTCCACAATATCCTACCCATAGCTACAACCTGATGACTAGTAACAAA CCTCATAAACATCGCCATCCCCCCCTCCATAAACTTCACCGGAGAGCTCCTAATTATATC CGCCCTATTTAACTGATGCCCAACAACAATCATCATACTAGGAATATCAATACTTATCAC CGCCTCTTACTCCCTACATATATTTCTGTCAACACAAATAGGGCCAACTCTACTAAACAA CCAAACAGAACCCACACACTCCCGAGAACACCTACTAATAACCCTCCACCTTGCCCCCCT ACTTATGATCTCCCTCAAACCAGAATTAGTCATCAGGAGTGTGCGTAATTTAAAGAAAAT ATCAAGCTGTGACCTTGAAAATAGATTAACCTCGCACACCGAGAGGTCCAGAAGACCTGC TAACTCTTCAATCTGGCGAA--CACACCAGCCCTCTCTTCTATCAAAGGAGAATAGTTA-CCCGCTGGTCTTAGGCACCACAACTCTTGGTGCAAATHow to getfrom this…How to getHow to getfrom this…from this…Automated DTCS(Dye Terminator Cycle Sequencing)AutomatedAutomatedDTCSDTCS(Dye Terminator Cycle Sequencing)(Dye Terminator Cycle Sequencing)• Typically provides accurate reads of 600-800 b.p.• For long fragments, two or more sequencing reactions are run• Up to 96 run at once in a plate••Typically provides accurate reads of 600Typically provides accurate reads of 600--800 b.p.800 b.p.••For long fragments, two or more For long fragments, two or more sequencing reactions are runsequencing reactions are run••Up to 96 run at once in a plateUp to 96 run at once in a plate••Reaction is similar to a PCR reaction, but Reaction is similar to a PCR reaction, but there is no logarithmic replication, so there is no logarithmic replication, so technically a primer extension reactiontechnically a primer extension reaction7ComponentsComponentsComponents• Purified PCR product (template)• Primer (1 per sequencing reaction)••Purified PCR product (template)Purified PCR product (template)••Primer (1 per sequencing reaction)Primer (1 per sequencing reaction)ComponentsComponentsComponents• Thermostable DNA polymerase• Buffer, MgCl2• Deoxynucleoside triphosphates (dNTPs)• Dideoxynucleoside triphosphates (ddNTPs)– Each with a different fluorescent label– Much smaller molar concentration than dNTPs••Thermostable DNA polymeraseThermostable DNA polymerase••Buffer, MgClBuffer, MgCl22••DeoxynucleosideDeoxynucleosidetriphosphates (triphosphates (dNTPsdNTPs))••Dideoxynucleoside triphosphates (Dideoxynucleoside triphosphates (ddNTPsddNTPs))––Each with a different fluorescent labelEach with a different fluorescent label––Much smaller molar concentration than Much smaller molar concentration than dNTPsdNTPs8ComponentsComponentsComponentsRibonucleosidetriphosphateRibonucleosideRibonucleosidetriphosphatetriphosphateDeoxynucleosidetriphosphateDeoxynucleosideDeoxynucleosidetriphosphatetriphosphateDideoxynucleosidetriphosphateDideoxynucleosideDideoxynucleosidetriphosphatetriphosphateRNARNADNADNADDNADDNAReactionReactionReaction• Similar to a PCR reaction:– Denature at ~96°C– Anneal primer at ~50°C– Extend primer at ~60°C• Primer extension occurs normally as long as dNTPs are incorporated• When a ddNTP is incorporated, extension stops••Similar to a PCR reaction:Similar to a PCR reaction:––Denature at ~96°CDenature at ~96°C––Anneal primer at ~50°CAnneal primer at ~50°C––Extend primer at ~60°CExtend primer at ~60°C••Primer extension occurs normally as Primer extension occurs normally as long as long as dNTPs dNTPs are incorporatedare incorporated••When a When a ddNTP ddNTP is incorporated, is incorporated, extension stopsextension stops9ReactionReactionReaction• Extension occurs via nucleophilic attack – 3’-hydroxyl group at the 3’ end of the growing strand– attacks the 5’-α-phosphate of the incoming dNTP,– releasing pyrophosphate (PPi).– (dNMP)n+ dNTP → (dNMP)n+1+ PPi– Catalyzed by DNA polymerase– Synthesis occurs 3’ → 5’••Extension occurs via nucleophilic Extension occurs via nucleophilic attack attack ––3’3’--hydroxyl group at the 3’ end of the hydroxyl group at the 3’ end of the growing strandgrowing strand––attacks the 5’attacks the 5’--αα--phosphate of the phosphate of the incoming incoming dNTPdNTP,,––releasing pyrophosphate (releasing pyrophosphate (PPPPii).).––((dNMPdNMP))nn+ + dNTP dNTP → (→ (dNMPdNMP))n+1n+1+ + PPPPii––Catalyzed by DNA polymeraseCatalyzed by DNA
View Full Document