Name:____________________________ 1 2007 7.013 Problem Set 3 Due before 5 PM on FRIDAY, March 16, 2007. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. Topic 1. You have been studying transcription in a type of yeast that is frequently used in wine-making. TATA binding factor (also known as TFIID) in these yeast cells strictly recognizes the sequence 5’-TATAAT-3’. Upon binding, TFIID recruits other components of the transcription apparatus to assemble. Once RNA polymerase has bound to this region, it begins transcribing after the 25th nucleotide downstream of the TATAAT sequence. Examine the following segments of chromosomal DNA from this species. In each case, write the first 10 nucleotides of the nascent messenger RNA that will be produced. Label the 5’ and 3’ ends of that molecule. 1a. 5’-GGCTATAATGCTCTACAGCAGACCCGGAAGCCCAGAGCAAACGCCAAGG-3’ 3’-CCGATATTACGAGATGTCGTCTGGGCCTTCGGGTCTCGTTTGCGGTTCC-5’* 5’ GAGCAAACGC 3’ 1b. 5’-TAATGCTCTATAATCAGCAGACCTCTATTCGCTTAGCCCAGAAGCACGA-3’ 3’-ATTACGAGATATTAGTCGTCTGGAGATAAGCGAATCGGGTCTTCGTGCT-5’* 5’ AGAAGCACGA 3’ 1c. 5’-GGCTATGATGCTCTACAGCAGACCCGGAAGCCCAGATTATACCGGATCG-3’* 3’-CCGATATTACGAGATGTCGTCTGGGCCTTCGGGTCTAATATGGCCTAGC-5’ 5’ CAUUAUAGCC 3’ For each of the above sequences, circle the template strand of the DNA. * templateName:____________________________ 2 Having studied this yeast for some time, you’ve learned that it contains many genes that encode very small proteins, and the genes often contain tiny introns. The intron splice sites in this species always have the composition 5’-GUG-3’ (for the 5’ splice site) and 5’-UUG-3’ (for the 3’ splice site), meaning that these sequences and everything between them will be removed from the mature message. Following are three genes from this species. Only the non-template strands are shown. In each case, identify the coding portions and the introns of each gene. Assume that translation always begins at the first methionine codon encountered, and that the introns get spliced out. In the space beneath each sequence, write out the primary sequence of the polypeptide that would be made. Use the translation table on the last page of this problem set. Please use the single letter abbreviations for each amino acid. Gene 1 5’-GACTATG,ATA,ACT,ATC,GTGCAGCAGACCCGGAAGCCCAGAAAACCACTGGATTGTCT,GGC,AGA,GAG,GCC,ACA,TGATC-3’ 1d. M I T I S G R E A T Gene 2 5’-ACAATG,TAC,TGC,GCG,ACG,CAC,GGTGACCACTTTCCCAGTTTTCCTTTCTTGCA,TCG,TTC,TTA,GAA,GCG,TCG,TAGAA-3’ 1e. M Y C A T H A S F L E A S Gene 3 5’-TAAATGTAT,ACC,CAT,ATC,AGC,ATT,TCG,GTG,GAA,CGA,TAT,CAC,GCT,AGA,GAT,TAA,TTGGAA,GCT,AGT,TAC,TGACCCA-3’ 1f. M Y T H I S I S E A S Y You’ve isolated several mutants from this species and found they each have subtle changes in the DNA sequences of the three genes listed above. Indicate what kind of mutation was involved in each case (Your choices are “missense,” “nonsense,” or “silent.”) 1g. Nucleotide 10 in gene 1 was changed from “A” to “G”: ____________missense 1h. Nucleotide 16 in Gene 1 was changed from “C” to “A”: silent 1i. Nucleotide 9 of Gene 2 was changed from “C” to “G”: nonsense 1j. Nucleotide 3 in Gene 3 was changed from “A” to “G”: silentName:____________________________ 3 1k. Examining the rest of the sequence of the mutated Gene 3 reveals that two more changes lie further downstream within this same gene, and that these mutations are not even in the exons. One of these converts the sequence 5’-GGAAC-3’ to 5’-CGAAC-3’. At the same time, the other mutation converts 5’-TTAATT-3’ to 5’-TTAAAT-3’. Do you expect these changes to change the translation product. If not, briefly explain why not in the space below (10 words or less). If it does change the translation product, then show the modified product in the space below. Intron is not spliced out, encodes AAs and stop codon: M Y T H I S I S V E R Y H A R D Topic 2 Towards the end of this problem set is the sequence of the alpha-tubulin gene from Zea mays. The sequence of the mature messenger RNA is also presented. Examine the sequence to answer the following questions. 2a. Where in the DNA sequence would you expect to find promoter sequences, including a TATA box? (Your choices are: “to the 5’ side of the transcription start site,” “to the 3’ side of the transcription start site,” or “within the first exon.” to the 5’ side of the transcription start site 2b. How many introns are there in this gene? 4 2c. How long is the 5’ UTR? 76 2d. How long is the 3’ UTR? 164 (including stop codon) 2e. How long is the mRNA (excluding the polyA tail and the cap)? 1590 bases 2f. How long was the pre-mRNA primary transcript (assuming no processing occurred until after transcription had been completed; assume also that the primary transcript ended where the current polyA tail begins)? 3218 bases 2g. How many amino acids make up the protein that will be translated directly from this transcript (before any post-translational modifications)? 450 AAs Topic 3 Having sequenced several alpha-tubulin genes in your laboratory, you notice that the alpha-tubulin gene from Zea mays differs from most other alpha-tubulins in one specific portion of the protein. The portion that differs most strongly is encoded by exon 2. You decide that to test the importance of these differences in the function of alpha-tubulin, you will transfer exon 2 from Zea mays into the alpha-tubulin gene from another species. The first step in doing this will requireName:____________________________ 4 you to obtain a copy of exon 2 by PCR. Using the sequence information of the alpha-tubulin gene on subsequent pages, describe two primers, each 10 bases in length, that could be used to precisely amplify exon 2 of alpha-tubulin. Write out the sequences of those primers in the space below. Be sure to label their 5’ and 3’ ends. 3a. Primer 1: 5’ TGATTCCTCG 3’ 3b. Primer 2: 5’ CGTGTAGTGG 3’Name:____________________________ 5 Topic 4 You have discovered a new plasmid in species of foul-smelling, soil dwelling bacteria. As a first step toward understanding the composition of this plasmid, you digest the plasmid with a series of restriction enzymes, either
View Full Document
Unlocking...