Nature © Macmillan Publishers Ltd 19988Crystal structure of a hepatitis deltavirus ribozymeAdrian R. Ferre´-D’Amare´*, Kaihong Zhou†& Jennifer A. Doudna*†* Department of Molecular Biophysics and Biochemistry, and†Howard Hughes Medical Institute, Yale University, New Haven, Connecticut 06520-8114, USA........................................................................................................................................................................................................................................................The self-cleaving ribozyme of the hepatitis delta virus (HDV) is the only catalytic RNA known to be required for theviability of a human pathogen. We obtained crystals of a 72-nucleotide, self-cleaved form of the genomic HDV ribozymethat diffract X-rays to 2.3 A˚resolution by engineering the RNA to bind a small, basic protein without affecting ribozymeactivity. The co-crystal structure shows that the compact catalytic core comprises five helical segments connected asan intricate nested double pseudoknot. The 59-hydroxyl leaving group resulting from the self-scission reaction is burieddeep within an active-site cleft produced by juxtaposition of the helices and five strand-crossovers, and is surroundedby biochemically important backbone and base functional groups in a manner reminiscent of protein enzymes.HDV is an RNA satellite virus of hepatitis B virus (HBV). Infectionof humans by both HBV and HDV is generally associated withmore severe hepatitis than that caused by HBV alone1. HDV has acircular, single-stranded RNA genome of 1,700 nucleotides, with,70% self-complementarity. This genome is thought to be repli-cated by the host RNA polymerase II through a double-rolling-circlemechanism1,2. Replication produces linear multimers of both geno-mic and antigenomic RNAs, both of which possess a self-cleavingactivity that processes the RNAs to unit length3–5. The activity hasbeen mapped to a catalytic-RNA, or ribozyme, domain whosefunction is required for HDV replication in vivo1. The HDVribozyme, which is active in vitro in the absence of any proteins,is the only known example of a catalytic RNA associated with ananimal virus. The circular single-stranded RNA genome, its mode ofreplication by a host RNA polymerase, and the self-cleaving-RNAactivity of HDV have close parallels in the plant viroids. Apart fromthe genomic and antigenomic ribozymes, however, there are noknown homologues of HDV ribozymes, and sequence variation ofthe HDV ribozymes in clinical isolates is minimal2.The self-cleavage reaction catalysed by the HDV ribozyme is atransesterification reaction, which yields products with 29,39-cyclicphosphate and 59-hydroxyl termini. Eighty-five contiguous nucleo-tides are required for activity of both genomic and antigenomicsequences6. Remarkably, the presence of a single nucleotide locatedimmediately 59 to the cleavage site is sufficient for cleavage, and theidentity of this −1 nucleotide has only small effects on the reactionrate2. On the basis of sequence comparison and compensatorymutagenesis studies, Perrotta and Been7proposed closely relatedsecondary-structure models for the genomic and antigenomic HDVribozymes that have a pseudoknot as their distinguishing feature(Fig. 1).The HDV ribozyme is the fastest known naturally occurring self-cleaving RNA, and also stands out among ribozymes because of itsstability to denaturants and its lack of requirement for specific metalions. The first-order rate constant for a genomic ribozyme has beenestimated to be 52 reactions per min at 37 8C (ref. 8). As the optimaltemperature in vitro is about 65 8C (ref. 9), this ribozyme can cleaveitself at a rate of more than 1 per second. For comparison, thehammerhead ribozyme cleaves itself at rates of about 1 per min (refs10, 11), and ribonuclease A cleaves UpG with a first-order rateconstant of 69 per second (ref. 12). Remarkably, the HDV ribozymeis active in 5 M urea or 18 M formamide13,14. The ribozyme seems tohave a nonspecific requirement for divalent cations for activity;cleavage is observed even in very low (,0.1 mM) concentrations ofCa2+,Mg2+,Mn2+or Sr2+, and at a reduced rate in the presence ofseveral other cations15.We have now determined the structure of the self-cleaved form ofa genomic HDV ribozyme by X-ray crystallography and refined theatomic model against diffraction data extending to 2.3 A˚resolution.The HDV ribozyme adopts an intricate fold that buries the activesite deep within a catalytic cleft. The structure is in agreement witharticlesNATURE|VOL 395|8 OCTOBER 1998|www.nature.com 567bcagcuaauuacgaugcgcgccgcgcg gcgccgcggccgcgauUGaucgcguagcnnGGGP3L3P1J1/2 P2P4J4/2L41020304050607080J1/4aUAu5'agcuaauCUcgaugcgcgcuagccgcguCCCGcGGaagccgcggcgccgUGGxugAgGCcc3'augcgccguacgcgcgcguaccga self-cleavageP1P2P3L3P4nnJ1/2J4/2L41020304050607080J1/4CU5'aaUCGuxugAAgG3'cauacggccacuggaacCCCFigure 1 Pseudoknotted secondary-structure models of a, genomic and b,antigenomic HDV ribozymes proposed by Perrotta and Been7. A pseudoknot is anucleic acid structure characterized by base-pairing between nucleotides in theloop of a conventional hairpin duplex with complementary residues outside thehairpin48. RNAs are numbered starting at the cleavage site1(large arrows). Base-paired regions are denoted P1 to P4 in a 59 to 39 direction; L3 and L4 are loopscapping the corresponding paired regions. Single-stranded segments joininghelices are indicated by J, followed by the helices they connect, in a 59 to 39direction, as J1/2, J1/4 and J4/2. X denotes the nucleotide preceding the cleavagesite, which can have any base. Upper-case letters denote nucleotides whosemutation results in marked reduction in ribozyme activity, and could not berescued bycompensatory mutations elsewhere. Lower-case letters mark nucleo-tides whose identity seems to be unimportant for ribozyme function8,9,30. Boxednucleotides correspond to those found to be strongly (grey) or weakly (white)protected from hydroxy-radical cleavage25. Two-headed arrows mark positions ofphotocrosslinks formed between an azidophenacyl group placed 59 to G1 andnucleotides in J4/2 (ref. 25).Nature © Macmillan Publishers Ltd 19988existing biochemical data, and provides a three-dimensional scaf-fold for understanding the mode of action of this unique RNAcatalyst.Crystallization and structure determinationThe P4 stem (Fig. 1) of the HDV ribozyme can be drasticallyshortened or mutagenized without detriment to the