BCHM465 Your Name: Biochemistry III, Molecular Genetics Prof. Jason KahnExam I March 6, 2001You have 80 minutes for this exam.Exams written in pencil or erasable ink will not be re-graded under any circumstances.Explanations should be concise and clear .You may need a calculator for this exam. No other study aids or materials are permitted.Generous partial credit will be given, i.e., if you don’t know, guess.1. Secondary Structure and Thermodynamics (20 pts):We discussed using thermal melting curves to analyze oligonucleotide thermodynamics.(a; 8 pts) Sketch a graph representing an absorbance thermal melting curve below , identifying theaxes, the portions of the curve corresponding to single-stranded and double-stranded DNA,and the Tm. What physical change does the melting curve monitor?Biochemistry 465 Exam I, 3/6/01 2 / 8 (b; 7 pts) Anything that changes when a nucleic acid goes from ds to ss can be used as the basisof a melting curve experiment. One example is the accessibility of an RNA nucleotide to asingle-strand specific enzyme like ribonuclease T1, which cuts at G. You are given the RNAoligonucleotide below, labeled at the 5’ end. Sketch the appearance of a polyacrylamide gelrun on samples reacted with ribonuclease T 1 as you increase the temperature from below T mto above T m as indicated .(c; 5 pts) You find experimentally that the melting temperatures you determine on the sameoligonucleotide using the two methods are different. Why might this be ? ACGUAUUCACGUCUAUACGUACC1231*23coldno rxn Tm Hot>TmABiochemistry 465 Exam I, 3/6/01 3 / 8 2. DNA Flexibility and Topology (20 pts).(a; 9 pts) DNA topology is a useful probe for ligand-induced structural changes. Imagine thatwithin the white box below, a ligand binds that induces a ∆Tw of +2 on an initially relaxedDNA. Draw the resulting shape of the DNA in Box B . Then we add a topoisomerase whichrelaxes away all writhe outside the box, and then we remove the topoisomerase and theligand. Draw the final result in box C . From topology alone, do we have any way of tellingwhether the ligand in the box introduced twist or writhe ? Why or why not?A. ?B. ?C.[Note added in proof: This is a clumsy question that no one got right. The picture in A shouldhave had the white box ligand off the DNA.]]The wormlike coil model describes the length dependence of apparent DNA flexibility.[Note that in F2001 I didn’t use the words wormlike coil but the ideas are the same](b; 8 pts) Give a very brief explanation of the essence of the wormlike coil model , in terms ofhow DNA behaves at short and long lengths. What quantity parametrizes the changeover ?Biochemistry 465 Exam I, 3/6/01 4 / 8 (c; 3 pts) We used the analogy of 100 pots of boiling water, each with a strand of spaghetti. Whatdid that have to do with DNA? 3. Base Pairing and Hybridization (20 pts).(a; 7 pts) In the space below, attached to the sugar given, draw a reasonable triple-base partner forthe G•G pair below, forming at least two hydrogen bonds. Does the third-strand backbonerun parallel or antiparallel to the G at the bottom left (circle one answer)?NHNNNNOH2NNNNNOHHRRHHOOHHHOOHBiochemistry 465 Exam I, 3/6/01 5 / 8 (b; 10 pts) DNA microarrays or “gene chips” are a transforming technology. Describe how youwould use a an expression profiling experiment to identify changes in gene expression due toinsulin or other hormone stimulation of cultured cells.(c; 3 pts) Based on (b) above, you might think that putting your college fund into Affymetrixstock would be a good idea. Drawing on the experience of people who invented in most of thehundreds of automobile companies that were around in 1910, why is this not necessarily thecase ?Biochemistry 465 Exam I, 3/6/01 6 / 8 4. Secondary structure prediction (18 pts).The essential RNA (i) below was proposed to form the structure shown based on computermodeling. Then homologous sequences (ii) and (iii) were discovered. The bases that differfrom RNA (i) are indicated in bold. The underlines are hints.AGUCGUGAAAACGACUGCACGACUG5101520255‘3‘AGUCGUGAAAACGACUCGACGACUGAGUCCUGAAAACAACUCGAGGACUGAGUACUGAAAACCACUCGAGUACUG510 15 20 255‘3‘i.ii.iii.i.(a; 4 pts) Explain the notion of correlated invariants in phylogenetic studies of RNA structure.(b; 3 pts) Why don’t the invariant bases in the sequences tell us as much about secondarystructure as the ones that do vary ?(c; 6 pts) Do the sequences (ii) and (iii) support the structure shown? Why or why not?Biochemistry 465 Exam I, 3/6/01 7 / 8 (d; 5 pts) Draw an alternative secondary structure that is more consistent with the phylogeneticdata.5. Miscellaneous (22 pts).(a; 6 pts) What are the two chemical differences between RNA and DNA? Why are there noorganisms with large RNA genomes?(b; 6 pts) Draw the structure of dCTP , with the numbering and identifying the α,β, and γ phosphates.Biochemistry 465 Exam I, 3/6/01 8 / 8 (c; 6 pts) Why is Mg++ or another divalent metal essential for RNA tertiary structure ? Can