The Genetic Code and Transcription DNA to RNA to Protein central dogma of molecular biology now know that the first step can sometimes go in the reverse direction because of the enzyme reverse transcriptase DNA to RNA to protein language of life summary of characteristics of the genetic material linear code of ribonucleotide letters derived from complementary DNA sequence words are triplets of ribonucleotide codons Cobe is unambiguous codon specifies 1 aa Code is degenerate 1 or more codons aa Start and stop codons initiate and terminate translation Translation without interruption commaless non overlapping code code is nearly universal only minor exceptions Basic Operational Patterns of Genetic Code How is the genetic information encoded Unstable intermediate between DNA and ribosomal postulated to be messenger RNA mRNA How to get 20 amino acids from 4 nucleotides if nucleotides read in groups of three 43 64 possibilities Crick and colleagues found that frameshifts of 1 or 2 nucleotides but not 3 caused mutations Nirenberg and Matthaei synthesized mRNAs using the enzyme Polynucleotide Phosphorylase and used these artificial messages in an in vitro protein synthesis system to make polypeptide sequences Figure 12 2 The effect of a frameshift mutations on a DNA sequence with the repeating triplet sequence GAG a The insertion of a single nucleotide shifts all subsequent triplet reading frames b The insertion of three nucleotides changes only two triplets but the frame of reading is then reestablished to the original sequence Cracking the Genetic code codons Homopolymer and Mixed Copolymer Experiments to determine composition of Polymers of single nucleotides allowed synthesis of homopolymers only e g polyU gave rise to polyphenylalanine By making RNA heteropolymers it was possible to deduce the composition of the triplet codons although not the exact sequence Mixed copolymer experiment 1st chart Results of a mixed copolymer experiment where a ratio of 2nd chart Results of a mixed copolymer experiment where a ratio of 1A 5C is used 1 6A 5 6C 1A 5C is used 1 6A 5 6C By analyzing the proportion of amino acids they could deduce which codons were being used Triplet binding experiments used to determine sequence of codons Could synthesize small triribonucleotides Ribosomes would bind these and cognate in medium Identify which each specific triribonucleotide i e which labeled amino acid would be retained in the ribosome complex Later made di tri and tetra ribonucleotide which he joined together as repeating co polymers used to confirm results of previous experiments Triplet binding assay In this assay the large ribosome complex only forms if correct pairing of charged tRNA and triplet occurs Coding conclusion from triplet binding assay trinucleotides AAA AAG AUG AUU AUC AUA CCG CCA CCU CCC CUC CUA CUG CUU GAA GAG UCA UCG UCU UCC UGU UGC UUA UUG UUU UUC Repeating copolymer experiment Amino acid Lysine Methionine Isoleucine Proline Leucine Glutamic acid Serine Cysteine Leucine Phenylalanine The genetic code reveals the function of the 64 triplets Dictionary of 61 triplets codons which are unambiguous in specifying 20 amino acids 3 codons specify termination no amino acid Degenerate code means that most amino acids are encoded by more than one codon some as many as six Leu and Arg First two nucleotides in codon more critical for attracting the correct tRNA to the mRNA message 3rd position wobble position has relaxed base pairing rules ATG start codon in bacteria is N formylmethionine fmet rarely GUG specifies a start formyl group removed after protein made Methionine start codon in eukaryotes Codon Anticodon Base pairing rules Note that codon and anticodon run ANTIPARALLEL as in ds Near Universality of the Genetic Code DNA Bye sequencing MS2 phage the DNA sequence and amino acid sequence of the encoded proteins were shown to be co linear co linearity 5 end NH2 terminus Cell free bacterial systems used to translated eukaryotic genes recombinant DNA molecules expressed correctly in different organisms Some exceptions In human mitochondria AUA met instead of ile Paramecium a protist UAA gln instead of STOP Yeast Mitochondria thr instead of leu CUA shifts in meaning occur in wobble position may represent economizing of universal code exceptions to the universal code Overlapping genes A single RNA may encode more than one protein if different translation initiation points are used AUGGGCAUUCGUUAUGGCCAUUAGAGGAAGU MetGlyIleArgTyrGlyHisSTOP MetAlaIleArgGlySer This has been found to be the case in some viruses such as X174 the 5385 nucleotide genome should encode a max of 1795 amino acids but in fact encodes 11 proteins that are a total of 2300 amino acids in length Seen in viruses that have to economize the length of the genetic material is more susceptible to the effects of mutation since one mutation may affect two proteins Transcription synthesis of RNA using a DNA template Idea that DNA acts as a template for RNA that directs protein synthesis on the ribosome Jacob and Monod 1961 Concept suggested by the facts that DNA is in the nucleus but protein synthesis is in the cytoplasm RNA is made in the nucleus and is like DNA most RNA moves out into the cytoplasm amount of cytoplasm is generally proportional to the amount of protein in a cell Concept supported by many phage and bacterial experiments By 1959 RNA polymerase was isolated it uses ribonucleotides instead of dideoxyribonucleotides and U instead of T In E coli it is a lar enzyme composed of several subunits holoenzyme the and subunits catalyze transcription A subunit named sigma plays a regulatory role in starting the process Eukaryotes have three distinct RNA polymerases RNA polymerase directs RNA synthesis RNA pol subunit binds to a DNA sequence upstream 5 of the gene different strengths of promoters region of DNA is unwound allowing region know as a promoter action of holoenzyme factors recognize different promoter sequences following initiation elongation occurs to stop codon Termination may be aided by a large protein r factor Fig 12 8 No primer is required for the first nucleotide 50 nuc sec At the end of gene the termination sequences from a hairpin like secondary structure termination may be dependent on a large protein names rho factor Transcription events in eukaryotes Eukaryotic mRNAs are monocistronic one open reading frame per message can be polycistronic in prokaryotes even overlapping genes Occurs within the nucleus using 3