NU BIOL 2301 - Metabolic pathways and disease

Unformatted text preview:

Metabolic pathways and diseaseLecture 2 – Genetics 101 continuedCentral Dogma DNA  RNA  ProteinTranscription DNA to RNABase pairing in DNA and RNADNA - RNA example workedTranslation - RNA to ProteinTranslation of mRNA into polypeptide chainGenetic Code is a Triplet CodeExample: PAH gene coding for the protein phenylalanine hydroxylase which breaks-down Phenylalanine into Tyrosine MutationsThe R408W mutant in the PAH gene Defective Phenylalanine hydroxylase causes Phenylketonuria (PKU)Make an mRNA transcript and translate to proteinMake an mRNA transcript and translate to proteinMake an mRNA transcript and translate to proteinMake an mRNA transcript and translate to proteinMake an mRNA transcript and translate to proteinMake an mRNA transcript and translate to proteinMake an mRNA transcript and translate to proteinGenes and EnvironmentEvolutionFig. 1.21EvolutionOrthologs – genes related by speciation Paralogs – gene related by duplication Example: Alpha and Beta HemoglobinsData on Genome & Proteome Sizes & SimilaritiesSlide Number 26Slide Number 271!"#$%&'()*+$#,-$./*$01*1(/"$/"A B C12D3Letters (A-D) are substrate or product molecules (metabolites)Numbers (1-3) are EnzymesWhich metabolites would be missing and which present in excess if you have a mutation in:Enzyme 1:Enzyme 2:Enzyme 3:Excess A, Missing B, C, DExcess B, Missing C, DExcess C, Missing D22")#34"*5*6 7"0"#()/*898*)&0#(03"17RGD\·V WRSLFV :"0#4$'*;&<=$*6 ;>?@#4$0/)4(+#(&0@A>?@#4$0/'$#(&0@B4&#"(0 7"0"#()*:&1" !3#$#(&0 CD&'3#(&0$4.*E4""*&F*'(F"3!"#$%&'()*+,&;>?*o A>?*o B4&#"(0;>?#4$0/)4(+#(&0A>?!"//"0<"4*A>?*G=A>?HE4$0/F"4*A>?*G#A>?HA(%&/&=$'*A>?*G4A>?H#4$0/'$#(&0B4&#"(0=A>?4E4$0/)4(+#(&0*;>?*#&*A>? E4$0/)4(+#(&0*I*+4&13)#(&0*&F*A>?*/#4$01*F4&=*;>?*#"=+'$#"*(0)'31(0<6 ="//"0<"4*A >?*G=A>?HJ*4(%&/&=$'*A>?/J*#4$0/F"4*A>?/ A>?*)&0#$(0/*#,"*%$/"*34$)('(0*+'$)"*&F*#,.=(0"*$01*#,"*/3<$4*4(%&/" (0/#"$1*&F*1"&K.4(%&/" A>?*(/*/.0#,"/(L"1*F4&=*#"=+'$#"*;>?*F&''&-(0<*/#4$01*/"+$4$#(&0*&F*#,"*1&3%'"*,"'(K6 · WR · GLUHFWLRQM(<*8N8O5P$/"*+$(4(0<*(0*;>?*$01*A>?;>?*6 A>?*+$(4/?1"0(0"*6 Q4$)('**********RQ4$)('*4"+'$)" /*E,.=(0"*(0*A>?SE,.=(0"*@ ?1"0 (0"73$0(0"*@ :.#&/(0"DNA 5’-ATGTCCACTGCGGTCCTGGAA-3’3’-TACAGGTGACGCCAGGACCTT-5’RNA 5’-AUGUCCACUGCGGUCCUGGAA-3’7UDQVFULSWLRQ RI P51$ RFFXUV LQ · - · GLUHFWLRQ ;>?*@ A>?*"K$=+'"*-&4T"163’-AGG TCT GGC ATG TCT CCT AAT CTG-5’ DNARNA5' - UCC AGA CCG UAC AGA GGA UUA GAC - 3'5' - TCC AGA CCG TAC AGA GGA TTA GAC - 3'7E4$0/'$#(&0*@ A>?*#&*B4&#"(0 =A>?*)&1"/ F&4*$=(0&*$)(1/* (0*+&'.+"+#(1"*),$(0 =A>?*#4$0/'$#"1 (0*0&0&D"4'$++(0<*<4&3+/*&F*#,4""*%$/"*)&1&0/ #,$#*/+")(F.*#,"*/"U3"0)"*&F*?=(0&*?)(1/*(0*+4&#"(0/ C$),*)&1&0*/+")(F("/*&0"*?=(0&*?)(1 E4$0/F"4*A>?/ G#A>?H*)&0#$(0*#4(+'"#*%$/"*/"U3"0) "/*I*$0#()&1&0/J*-,(),*$4"*)&=+'"="0#$4.*#&*)&1&0/*(0*=A>?8M(<*8N8VE4$0/'$#(&0*&F*=A>?*(0#&* + &'.+"+#(1 "*),$(0E4$0/'$#(&0*&))34/*$#*#,"*4(%&/&="/*-,(),*) & 0#$(0*W*#.+"/*&F*4A>?97"0"#()*:&1"*(/*$*E4(+'"#*:&1"U C A G1stUUU (Phe/F)Phenylalanine UCU (Ser/S)Serine UAU (Tyr/Y)Tyrosine UGU (Cys/C)Cysteinebase UUC (Phe/F)Phenylalanine UCC (Ser/S)Serine UAC (Tyr/Y)Tyrosine UGC (Cys/C)CysteineUUA (Leu/L)LeucineUCA (Ser/S)SerineUAA STOP UGA STOPUUG (Leu/L)Leucine UCG (Ser/S)SerineUAG STOPUGG (Trp/W)TryptophanCUU (Leu/L)LeucineCCU (Pro/P)Proline CAU (His/H)Histidine CGU (Arg/R)ArginineCUC (Leu/L)Leucine CCC (Pro/P)Proline CAC (His/H)Histidine CGC (Arg/R)ArginineCUA (Leu/L)Leucine CCA (Pro/P)ProlineCAA (Gln/Q)GlutamineCGA (Arg/R)ArginineCUG (Leu/L)Leucine CCG (Pro/P)Proline CAG (Gln/Q)Glutamine CGG (Arg/R)ArginineAUU (Ile/I)Isoleucine ACU (Thr/T)Threonine AAU (Asn/N)AsparagineAGU (Ser/S)SerineAUC (Ile/I)Isoleucine ACC (Thr/T)Threonine AAC (Asn/N)Asparagine AGC (Ser/S)SerineAUA (Ile/I)Isoleucine ACA (Thr/T)Threonine AAA (Lys/K)Lysine AGA (Arg/R)ArginineAUG (Met/M)Methionine STARTACG (Thr/T)Threonine AAG (Lys/K)Lysine AGG (Arg/R)ArginineGUU (Val/V)Valine GCU (Ala/A)Alanine GAU (Asp/D)Aspartic acid GGU (Gly/G)GlycineGUC (Val/V)Valine GCC (Ala/A)Alanine GAC (Asp/D)Aspartic acid GGC (Gly/G)GlycineGUA (Val/V)Valine GCA (Ala/A)AlanineGAA (Glu/E)Glutamic acidGGA (Gly/G)GlycineGUG (Val/V)Valine GCG (Ala/A)Alanine GAG (Glu/E)Glutamic acid GGG (Gly/G)GlycineAG2nd baseUCAC;Q>;?>E*:&1"* SRVVLEOH FRPELQDWLRQV RI  QXFOHRWLGHV [[ P3#*&0'.*59*?=(0&*?)(1/*G??/H*XY*#,"4"*$4"*=& 4"*#,$0*&0"*)&1&0*+"4*??X+")($'*:&1&0/Z XE?AE*:&1&0*I*?Q7*!"#,(&0 (0" 6723 &RGRQV 8$$ 8$* 8*$10CK$=+'"Z*B?[*<"0"*)&1(0<*F&4*#,"*+4&#"(0*+,"0.'$'$0(0"*,.14&K.'$/"*-,(),*%4"$T/@1&-0*B,"0.'$'$0(0"*(0#&*E.4&/(0"*M(<*8N\11!3#$#(&0/ !3#$#(&0 4"F"4/*#&*$0.*,"4(#$%'"*),$0<"*(0*$*<"0" E,"*),$0<"*=$.*%"Z6 X3%/#(#3#(&0*& F *&0"*;>?*%$/"*+$(4*F&4*$0&#,"4*%$/" >3)'"&#(1"/*/3%/#(#3#(&0/6 6\QRQ\PRXV GRHVQ·W FKDQJH DPLQRDFLG $$ VHTXHQFH6 >&0 @/.0&0.=&3/*I*),$0<"/ *??*&4*+4&#"(0*6 ;"'"#(&0*&4*]0/"4#(&0*&F*%$/"*+$(4/ YF#"0*)$3/"/*F4$="/,(F#*(0*+4&#"(0*/"U3"0)" !3#$#(&0/*)$0*)$3/"*#,"*(0/"4#(&0*&F*$0*(0)&44")#*$=(0&*$)(1*(0*$*+4&#"(0*$01* (=+$(4*(#/*F30)#(&012E,"*AW9^_*=3#$0#*(0*#,"*B?[<"0";"F")#(D"*B,"0.'$'$0(0"*,.14&K.'$/"*)$3/"/B,"0.'T"#&034($*GB`QHM(<N*8N8a.*#/,0$&# $(!11(2(3%+4#4#"13!$T"*$0*=A>?*#4$0/)4(+#*$01*#4$0/'$#"*#&*+4&#"(0First translate the DNA into RNA (use the bottom DNA strand as the transcribe strand)DNA5’-AGTAGAATGCTTCGAAGCTCTAGTGGTGATCGCCTTTAGTCTTCCTTG-3’3’-TCATCTTACGAAGCTTCGAGATCACCACTAGCGGAAATCAGAAGGAAC-5’Remember to switch Uracil (U) for Thymine (T) in RNA5' - AGUAGAAUGCUUCGAAGCUCUAGUGGUGAUCGCCUUUAGUCUUCCUUG - 3'14!$T"*$0*=A>?*#4$0/)4(+#*$01*#4$0/'$#"*#&*+4&#"(0First translate the DNA into RNA (use the bottom DNA strand as the transcribe strand)DNA5’-AGTAGAATGCTTCGAAGCTCTAGTGGTGATCGCCTTTAGTCTTCCTTG-3’3’-TCATCTTACGAAGCTTCGAGATCACCACTAGCGGAAATCAGAAGGAAC-5’5’-AGUAGAAUGCUUCGAAGCUCUAGUGGUGAUCGCCUUUAGUCUUCCUUG-3’mRNARemember to switch Uracil (U) for Thymine (T) in RNA15!$T"*$0*=A>?*#4$0/)4(+#*$01*#4$0/'$#"*#&*+4&#"(0First translate the DNA into RNA (use the bottom DNA strand as the transcribe strand)DNA5’-AGTAGAATGCTTCGAAGCTCTAGTGGTGATCGCCTTTAGTCTTCCTTG-3’3’-TCATCTTACGAAGCTTCGAGATCACCACTAGCGGAAATCAGAAGGAAC-5’5’-AGUAGAAUGCUUCGAAGCUCUAGUGGUGAUCGCCUUUAGUCUUCCUUG-3’mRNANow we need to translate the mRNA into protein.16!$T"*$0*=A>?*#4$0/)4(+#*$01*#4$0/'$#"*#&*+4&#"(0First translate the DNA into RNA (use the bottom DNA strand as the transcribe


View Full Document

NU BIOL 2301 - Metabolic pathways and disease

Documents in this Course
Load more
Download Metabolic pathways and disease
Our administrator received your request to download this document. We will send you the file to your email shortly.
Loading Unlocking...
Login

Join to view Metabolic pathways and disease and access 3M+ class-specific study document.

or
We will never post anything without your permission.
Don't have an account?
Sign Up

Join to view Metabolic pathways and disease 2 2 and access 3M+ class-specific study document.

or

By creating an account you agree to our Privacy Policy and Terms Of Use

Already a member?