Lecture 16 New study Specific damage of DNA like translocation transposition this rearrangement known to cause cancer new thing in this study is an enzyme in this that damages eukaryotic cells specifically B cell lymphocytes and makes them target for translocation Barbara McClintock how corn plants reproduced she discovered transposition while working with Indian corn o Each different colored kernel represent DNA rearrangements o Translocation DNA in nucleus was broken and put a different way Phages o Phage attacks host cell and marks it for death phage replicates itself in host cell and destroys the host cell DNA o Most of the time progeny phage contain only phage genome o Transducing phage sometimes rarely phage assembly packaging machinery makes a mistake and packages DNA fragment from host cell instead of phage This phage may now put this DNA into another cell and give that cell these genes can infect Restriction endonucleases in bacteria are barriers to gene transfer restrict what the phage o Restriction enzymes Enzymes that cleave DNA o Each cuts DNA at different specific recognition sequence o Don t cut cells own DNA protection by methylation o So when phage injects its DNA in the host the host can recognize it is not its own DNA because it is not methylated recognized as foreign DNA and it begins to be cut up and is degraded by restriction enzymes Different restriction endonucleases cleave DNA at different specific nucleotide sequences The restriction enzyme EcoRI recognizes the DNA sequence GAATTC How many times would it cleave the sequence o 5 CTCTTAAGTAGCATGCATCGAATTC 3 3 GAGAATTCATCGTACGTAGCTTAAG 5 o Answer together Size in base pairs can use restriction enzymes to measure the size of plasmids o Ex put 3 different restriction enzymes in plasmid and then add the cut sequences Restriction Enzymes cut DNA at locations with specific and usually palindromic nucleotide sequences called restriction sites o You can use this technique to get sticky ends o Restriction fragments form two different organisms cut by the same restriction enzymes have the same sticky ends so they can stick together o Ligase sticks them together and you can get recombinant DNA molecules o Can also use blunt ends to do recombinant DNA molecules with blunt ends you do not need to worry about it rematching up ligase will just stick the two different organisms together o You can use this mechanism to put DNA into a plasmid restriction enzymes and put this plasmid with new DNA genes into another cell and grow this bacteria with this new phenotype Problem with the above method and eukaryotes In eukaryotes you need to remove all the introns the easiest way to do this is to start with the mRNA the mRNA of the eukaryote has all the introns removed o Reverse transcriptase enzyme that can take mRNA back to DNA this way you solely have just the DNA sequence of the expressed gene that you want o If you had put a eukaryotic sequence into a plasmid with the introns and exons it would express the gene all together with both and probably be not functional PCR polymerase chain reaction like a copy machine for DNA oligonucleotides copy from the template strand 2 goes to 4 4 goes to 8 8 does to 16 etc o Oligonucleotides amplify the DNA The lac operon if you insert a gene in place of the lac gene sequence ZYA using restriction enzymes you will express this gene instead you will change the phenotype o Depending on how much you left of the B galactosidase gene it will be expressed and it might or might not be functional o Cells grown with X gal will then be white if there is not enough of the B galactosidase gene expressed to make it functional and able to break down the lactose o Know what lactose lacI what xgal is and B galactosidase o Screening seeing if your colonies with your new gene grew for example if you replaced lac ZYA gene with GFP and got glowing colonies when you plated it your gene in the plasmid was expressed screens involve cells that are alive ex producing antibiotic glowing blue or green etc Transcriptional fusion doing what was explained above using a promoter that is already there such as the lacZ gene promoter and putting a different gene to be expressed after it o Reporter protein synthesis starts at its own start codon o Used to study transcriptional regulation signals o Uses gene under study s ribosome binding site Side note You see blue color from Xgal o If plasmid has lac in it but has a replaced b galactosidase gene it will be white Translational fusion his example from class after lacZ gene right when it is about to hit its stop codon you put GFP in instead of the stop codon and you get the lacZ gene and the GFP and your culture is blue and glowing green o Reporter protein is fused to start codon of gene under study o Used to study protein localization signals How do you know that the plasmid is in the cell o Plasmid vectors are engineered o Contain genes for antibiotic resistance o So then you can perform a transformation experiment you plate bacteria on a media with antibiotic cells without the plasmid will die while cells with the plasmid will grow selection o 2 step process select for organism of interest then you demonstrate that it has the plasmid of interest by plating it on a media and explaining why it grows now Where does transcription start Answer 10 base pairs downstream from the promoter o Why It does not start at the start codon this is where translation starts and you need a RBS upstream of where translation starts If you started at the start codon you wouldn t have a RBS for ribosomes to bind to to start translation of the gene Mutation put a stop codon in therefore a nonsense mutation no way to translate it nonfunctional Nonsense mutation change DNA sequence to inframe stop codon Missense mutation alters the primary DNA sequence o Silent o Structural Base pair substitutions o Transition pyrimidine to pyrimidine o Transversion pyrimidine to purine o Purines A G o Pyrimidines C T Gfp is a eukaryotic gene To express this gene in a bacterium the DNA would need to contain Answer a prokaryotic promoter Why doesn t every gene start at every ATG sequence ATG is a start codon also is AUG used in most eukaryotes o Not every ATG site in the cell is a site for translation of a protein because not every ATG in a cell is proceeded by a promoter or it doesn t have a RBS upstream of it Synthetic biology involves two main areas o Engineering small devices and systems to use them Creating