Exam 2 Genes and Genetics What Are Genes Definition A molecular unit of heredity of a living organism Cells basic unit of organization Genes basic unit of heredity Sum total of all of your genes is called the genome Heredity The process in which traits are passed from parent to offspring child You inherit traits from your parents and grandparents Eye color hair color etc Genes and Genetics In the 21st century one of the dominant forces for human advancement legal clinical economic technological and ethical that will affect you daily life will be found in the fields of genetics and genetic engineering It has already begun Over the Counter Genetics 23andMe Genetic testing 99 Information 250 genetic links involving health conditions and traits Carrier status Health risks Drug responses Ancestry Time Magazine s Invention of the Year 2008 Over the Counter Genetics Genes and Genetics The problem is that we are overrun by a massive amount of information that is poorly reported in the media or ill understood by consumers for lack of familiarity with how genes and genetics work Genetics in Popular Culture BRCA1 Human gene Certain versions greatly increased risk of breast cancer Genetic testing by only one company Myriad Genetics Genetics in Law Business Supreme Court case Association for Molecular Pathology v Myriad Genetics Ruling Naturally occurring genes may not be patented Modified genes can be patented Genetics in Journalism So what is a gene exactly A gene is a concept it is the way scientists organize the information contained within DNA DNA and Information Let s use a metaphor Imagine that a living cell is a computer The DNA is the hard drive where the instructions for running the cell are stored Like a hard drive DNA is used to store information How is information stored in DNA the molecules that carry the genes that are passed from parent to child Genes and DNA DNA Deoxyribonucleic Acid Hereditary material Double helix shape Twisted ladder Long chain of nucleotides Sugar phosphate rails of ladder Base rungs DNA 4 different kinds of base A G T C The order of these bases is a chemical language Genetic sequence AACTGATCGATCGATCGCGCTACGCTATTAGCCGATCACGTACTAGCATC ACTGAATGACATCGACTAGCT Returning to the computer metaphor Computers use a two number code 1 and 0 1010101011101011010101011010101 DNA uses a four letter code A G T C ACGCTCGATCGGCTATAACTCTTCTCCC DNA How much DNA Humans Largest 3 billion bases letters If laid out end to end each cell contains 6 feet of DNA Paris japonica Rare Japanese flower 149 billion bases Smallest Carsonella ruddii Bacterium causes infections in insects 160 000 bases DNA Organization In humans DNA is not one long molecule 23 chromosomes Organized structure of DNA and other molecules 22 chromosomes plus 1 sex chromosome Two types X and Y Each cell has two sets 1 from mother 1 from father We ve established that DNA stores information instructions to run the cell in the genetic code What do those instructions make Proteins Proteins do the work of the cell Est 50k 60k different kinds of proteins in humans Made of amino acids Long chains polymers Folds on top of itself many times to make 3D shape Shape can determine the kind of job the protein does Kinds of Proteins Enzymes Proteins that perform chemical reactions Names usually end in ase Example Lactase Helps catabolize lactose Milk sugar Some people stop making lactase Lactose intolerance Kinds of Proteins Binding Attaching to other things or having other things attach to it Hemoglobin Oxygen binding protein Carries oxygen from lungs to other parts of the body through blood Red blood cells Kinds of Proteins Structure and Protection Some proteins are built for physical strength Collagen Long and rope like Both flexible and physically strong Cartilage tendons ligaments So DNA contains the information necessary to make the proteins that do the work to keep cells alive What does this have to do with genes EVERYTHING DNA Proteins and Genes A gene is both a concept and a definable thing Definition All of the genetic sequences necessary to make a protein From Genes to Traits Recap DNA is the hereditary material that carries the genes passed on to you from your parents A gene is both The molecular unit of heredity All of the genetic sequences necessary to make a protein This information is stored in your DNA in your genetic sequence The order of the nucleotides in your DNA 4 kinds by base adenine A guanine G cytosine C and thymine T Sugar and phosphate hold chain together bases inward like rungs of a ladder The information stored in DNA is used to make proteins Proteins do the work of the cell Metabolism structure protection attachment movement etc Many different kinds including enzymes binding proteins structural proteins What is a Trait Vocabulary time different forms Characteristic any biological feature that exists in a variety of Examples eye color hair color type facial shape ear wiggling bitter tasting tongue rolling Trait The distinct forms of a characteristic Example eye colors come in blue brown gray green hazel etc Essentially we are asking this question How do our genes determine our visible or otherwise measurable characteristics A It s complicated The LONG answer is Sometimes it s simple and sometimes it s complicated Sometimes we scientists don t know all of the factors that are important One thing is always true complex characteristics require complex explanations How do genes become proteins Gene Expression Gene Expression The process by which genetic information is used to make a protein Two step process Transcription The DNA sequence is copied into an RNA sequence Genetic information moves to ribosome Translation a ribosome The information in RNA is read by a molecular machine called Ribosome builds the protein from scratch using amino acids DNA only stores information it can not move information around In order for a gene to be made into a protein it must first be copied into a form that can move thus transcription into RNA How does the cell know when to copy a gene into RNA Transcription Genes contain two types of information Coding sequence The recipe Regulatory sequences Instructions for making a protein using genetic code Proteins that bind DNA sequences can turn on or turn off transcription 1 or more A question for discussion Why not make all proteins all the time So a protein is needed and the cell turns on transcription for that gene How does that RNA molecule get made into a protein The