Biology 107 Spring 2021Lab Week 3 Discussion(Week of Feb 1)Topics: Central Dogma, Open Reading Frames and Genes1. What’s the difference between an open reading frame and a gene? Do all translated (coding) genes haveto have an open reading frame?Open reading frame: start and stop and everything. However long you get before stopping the codon.Gene: coding for a protein Open reading frames(ORFs) are parts of areading framethat contain no stop codons. Areading frameis a sequence of nucleotide triplets that arereadas codons specifying amino acids; a single strand of DNA sequence has three possiblereading frames. 2. How are there 6 different reading frames in DNA when there are only 2 strands of DNA?The longer an open readingframeis, the longer you get before you get to a stop codon, the more likely it is to be part of agenewhich is coding for a protein. ... So, it's actuallysix differentreadingframesfor every piece ofDNA, which might give you an open readingframe.(DNA model to help you think about this question)5’ TCAACATGGATGCCGTATAGCCTAGGCATCTAA 3’3’ AGTTGTACCTACGGCATATCGGATCCGTAGATT 5’3. Why is it unlikely that there are overlapping genes in the DNA, even though there are 6 reading frames? means that the same letter is not used for two different codons. In other words, no single base can take part in the formation of more than one codon. Prosocial 2, Spring
View Full Document
Unlocking...