UB BIO 329 - Designing gRNA for CRISPR_Bio329 (2) (14 pages)

Previewing pages 1, 2, 3, 4, 5 of 14 page document View the full content.
View Full Document

Designing gRNA for CRISPR_Bio329 (2)



Previewing pages 1, 2, 3, 4, 5 of actual document.

View the full content.
View Full Document
View Full Document

Designing gRNA for CRISPR_Bio329 (2)

146 views


Pages:
14
School:
University at Buffalo, The State University of New York
Course:
Bio 329 - Genetics Laboratory
Unformatted text preview:

Lab 4 4 Designing gRNA for CRISPR Guide RNA gRNA CRISPR RNA crRNA In the bacterial genome this is the transcribed region of the unique spacer sequences found in CRISPR regions The transcribed spacer region guides the Cas proteins to foreign genetic elements contained in the viral DNA genome The guide RNA for CRISPR gene editing is usually 20 nt in length and corresponds to sequences within the target gene Protospacer Adjacent Motif PAM PAM Protospacer Adjacent Motif Specific DNA sequence that must follow the target DNA sequence in order for Cas9 to bind and cut DNA Cas9 from Streptococcus pyogenes the protein for this lab has a PAM sequence of NGG Novel PAM sequences have been identified in other Cas like protein systems Selecting DNA sequences for gRNA Step 1 Select a gene In this case we are using the first 180 nt of ADE2 gene in yeast ATGGATTCTAGAACAGTTGGTATATTAGGAGGGGGACAATTGGGACGTATGATTGTTGAGGCAGC AAACAGGCTCAACATTAAGACGGTAATACTAGATGCTGAAAATTCTCCTGCCAAACAAATAAGCA ACTCCAATGACCACGTTAATGGCTCCTTTTCCAATCCTCTTGATATCGAA Selecting DNA sequences for gRNA contd STEP 2 Go to the following CRISPR Direct website http crispr dbcls jp Selecting DNA sequences for gRNA contd Step 3 Delete the sample sequence and paste the sequence of your gene of interest Step 4 Should be Step 5 Change the NGG specificity check to Budding yeast Saccharomyces cerevisiae Selecting DNA sequences for gRNA contd Step 6 Once all the changes are made click design Step 7 Looking at the Results A Target Position Understanding the Results B Target Sequences 20mer 3mer PAM total 23 mer C GC content of the target 20mer D Calculated Tm of the target 20mer E Presence or absence of TTTT four consecutive T s that cause pol III termination in the target 20mer Avoid TTTT in gRNA vectors with pol III promoter F Off target search results against genomic sequence The number of target sites with perfect match is shown The number displayed here includes both on target and offtarget sites Smaller number but not zero is better for these columns to avoid off target editing Understanding the Results Off target A different gene that contains a similar 23 base pair sequence to the gene we want to edit Then because of the similar sequence it might be also recognized by the guide RNA therefore producing off target editing It is important to use a sequence that occurs only in the gene we want to edit and not elsewhere in the genome to avoid off target editing G Only one match in 20mer PAM and 12mer PAM search These targets are highly specific Recommended for CRISPR Cas target Target positions are highlighted with green e g 163 185 H No match in 20mer PAM search Possibly the sequence spans over exon exon junction so avoid using these Not recommended for CRISPR Cas target I Very high number of off target hits Avoid using these sequences Not recommended for CRISPR Cas target Understanding the Results Any target sequence that is not followed by this three base sequence NGG where N any base and G guanine bases will not be recognized by the CRISPR guide RNA complex Forward Strand sequence ends in TGG PAM sequence Reverse Strand sequence begins with CCA complimentary to GGT PAM sequence Step 8 Selecting target sequences Sequence selected for this experiment Step 9 Determining the Guide RNA gRNA The guide RNA sequence itself cannot contain the PAM sequence Thus the guide RNA for this sequence identified by CRISPR direct would be three bases shorter than the target sequence with the PAM removed from the 3 end Lab Assignment You will be emailed the STE12 sequence Following the directions in this powerpoint find out 4 appropriate target sequences on CRISPRdirect Take a screenshot of your results page You must print it out and attach it to your lab report You MUST find 2 target sequences on the positive strand and 2 on the negative strand Write down the 4 sequences and the 4 corresponding guide RNA sequences Write them 5 3


View Full Document

Access the best Study Guides, Lecture Notes and Practice Exams

Loading Unlocking...
Login

Join to view Designing gRNA for CRISPR_Bio329 (2) and access 3M+ class-specific study document.

or
We will never post anything without your permission.
Don't have an account?
Sign Up

Join to view Designing gRNA for CRISPR_Bio329 (2) and access 3M+ class-specific study document.

or

By creating an account you agree to our Privacy Policy and Terms Of Use

Already a member?