UB BIO 329 - Designing gRNA for CRISPR_Bio329 (2) (14 pages)
Previewing pages 1, 2, 3, 4, 5 of 14 page document View the full content.Designing gRNA for CRISPR_Bio329 (2)
Previewing pages 1, 2, 3, 4, 5 of actual document.
View the full content.View Full Document
Designing gRNA for CRISPR_Bio329 (2)
0
0
126 views
- Pages:
- 14
- School:
- University at Buffalo, The State University of New York
- Course:
- Bio 329 - Genetics Laboratory
Unformatted text preview:
Lab 4 4 Designing gRNA for CRISPR Guide RNA gRNA CRISPR RNA crRNA In the bacterial genome this is the transcribed region of the unique spacer sequences found in CRISPR regions The transcribed spacer region guides the Cas proteins to foreign genetic elements contained in the viral DNA genome The guide RNA for CRISPR gene editing is usually 20 nt in length and corresponds to sequences within the target gene Protospacer Adjacent Motif PAM PAM Protospacer Adjacent Motif Specific DNA sequence that must follow the target DNA sequence in order for Cas9 to bind and cut DNA Cas9 from Streptococcus pyogenes the protein for this lab has a PAM sequence of NGG Novel PAM sequences have been identified in other Cas like protein systems Selecting DNA sequences for gRNA Step 1 Select a gene In this case we are using the first 180 nt of ADE2 gene in yeast ATGGATTCTAGAACAGTTGGTATATTAGGAGGGGGACAATTGGGACGTATGATTGTTGAGGCAGC AAACAGGCTCAACATTAAGACGGTAATACTAGATGCTGAAAATTCTCCTGCCAAACAAATAAGCA ACTCCAATGACCACGTTAATGGCTCCTTTTCCAATCCTCTTGATATCGAA Selecting DNA sequences for gRNA contd STEP 2 Go to the following CRISPR Direct website http crispr dbcls jp Selecting DNA sequences for gRNA contd Step 3 Delete the sample sequence and paste the sequence of your gene of interest Step 4 Should be Step 5 Change the NGG specificity check to Budding yeast Saccharomyces cerevisiae Selecting DNA sequences for gRNA contd Step 6 Once all the changes are made click design Step 7 Looking at the Results A Target Position Understanding the Results B Target Sequences 20mer 3mer PAM total 23 mer C GC content of the target 20mer D Calculated Tm of the target 20mer E Presence or absence of TTTT four consecutive T s that cause pol III termination in the target 20mer Avoid TTTT in gRNA vectors with pol III promoter F Off target search results against genomic sequence The number of target sites with perfect match is shown The number displayed here includes both on target and offtarget sites Smaller number but not zero is
View Full Document