Slide 1Guide RNA (gRNA); CRISPR RNA (crRNA)Protospacer Adjacent Motif (PAM)Selecting DNA sequences for gRNASelecting DNA sequences for gRNA (contd…)Selecting DNA sequences for gRNA (contd…)Selecting DNA sequences for gRNA (contd…)Step 7: Looking at the ResultsUnderstanding the Results!Understanding the Results!Understanding the Results!Step 8: Selecting target sequencesStep 9: Determining the Guide RNA (gRNA)Lab AssignmentLab 4.4 Designing gRNA for CRISPRGuide RNA (gRNA); CRISPR RNA (crRNA)•In the bacterial genome, this is the transcribed region of the unique “spacer” sequences found in CRISPR regions. •The transcribed spacer region guides the Cas proteins to foreign genetic elements contained in the viral DNA genome.• The guide RNA for CRISPR gene editing is usually 20 nt in length, and corresponds to sequences within the target gene.Protospacer Adjacent Motif (PAM)•PAM: Protospacer Adjacent Motif. Specific DNA sequence that must follow the target DNA sequence in order for Cas9 to bind and cut DNA. •Cas9 from Streptococcus pyogenes, the protein for this lab, has a PAM sequence of NGG. Novel PAM sequences have been identified in other Cas-like protein systems.Selecting DNA sequences for gRNA •Step 1: Select a gene. In this case we are using the first 180 nt of ADE2 gene in yeast:ATGGATTCTAGAACAGTTGGTATATTAGGAGGGGGACAATTGGGACGTATGATTGTTGAGGCAGCAAACAGGCTCAACATTAAGACGGTAATACTAGATGCTGAAAATTCTCCTGCCAAACAAATAAGCAACTCCAATGACCACGTTAATGGCTCCTTTTCCAATCCTCTTGATATCGAA77Selecting DNA sequences for gRNA (contd…) http://crispr.dbcls.jp/STEP 2: Go to the following CRISPR Direct website:Selecting DNA sequences for gRNA (contd…) Step 3: Delete the sample sequence and paste the sequence of your gene of interestStep 5: Change the specificity check to Budding yeast (Saccharomyces cerevisiae)Step 4: Should be NGGSelecting DNA sequences for gRNA (contd…) Step 6: Once all the changes are made, click designStep 7: Looking at the Results•A: Target Position•B: Target Sequences, 20mer+3mer PAM (total 23 mer)•C: GC content of the target 20mer.•D: Calculated Tm of the target 20mer.•E: Presence or absence of TTTT (four consecutive T’s that cause pol III termination) in the target 20mer. Avoid TTTT in gRNA vectors with pol III promoter.•F: Off-target* search results against genomic sequence. The number of target sites with perfect match is shown. The number displayed here includes both on-target and off-target sites. Smaller number (but not zero) is better for these columns to avoid off-target editing.Understanding the Results!Understanding the Results!•G: Only one match in 20mer+PAM and 12mer+PAM search. These targets are highly specific.→ Recommended for CRISPR/Cas target. Target positions are highlighted with green (e.g., 163 - 185).•H: No match in 20mer+PAM search. Possibly the sequence spans over exon-exon junction, so avoid using these.→ Not recommended for CRISPR/Cas target.•I: Very high number of off-target hits. Avoid using these sequences.→ Not recommended for CRISPR/Cas target.•Off-target: A different gene that contains a similar 23 base pair sequence to the gene we want to edit. Then because of the similar sequence, it might be also recognized by the guide RNA, therefore producing “off-target editing. It is important to use a sequence that occurs only in the gene we want to edit, and not elsewhere in the genome, to avoid off-target editing.Understanding the Results!Forward Strand, sequence ends in TGG (PAM sequence)Reverse Strand, sequence begins with CCA (complimentary to GGT PAM sequence)*Any target sequence that is not followed by this three base sequence (NGG, where N = any base, and G = guanine bases) will not be recognized by the CRISPR/guide RNA complex!!!Step 8: Selecting target sequencesSequence selected for this experimentStep 9: Determining the Guide RNA (gRNA)The guide RNA sequence itself cannot contain the PAM sequence. Thus, the guide RNA for this sequence, identified by CRISPR direct, would be three bases shorter than the target sequence, with the PAM removed from the 3’ end.Lab Assignment•You will be emailed the STE12 sequence.•Following the directions in this powerpoint, find out 4 appropriate target sequences on CRISPRdirect.•Take a screenshot of your results page. You must print it out and attach it to your lab report.•You MUST find 2 target sequences on the positive strand and 2 on the negative strand.•Write down the 4 sequences and the 4 corresponding guide RNA sequences (Write them