Slide 1Slide 2Slide 3Slide 4Slide 5Slide 6Slide 7Slide 8Slide 9Slide 10Slide 11Slide 12Slide 13Slide 14DNA replication in EukaryotesSlide 16Slide 17Slide 18Slide 19Slide 20Slide 21Slide 22More on the importance of TelomeraseHow is a Repl. origin selected? Priming at the oriC (Bacterial) OriginSlide 25Slide 26Slide 275'3'3'5'5'5'DNA Polymerase IIIacts hereDNA Polymerase I extendsone Okazaki fragment andremoves the RNA fromanother.DNA Ligase then joinsfragments together.ssDNA bindingprotein (SSB)Helicase (DnaB)Primase3'GyraseS p in n in gat 10,000rp mA prokaryo tic fork is trav elling at 50 to 100 kb / m inute.Eukaryotic forks trav el at 0.5 - 5 kb / m inute.PrimosomeA ReplisomePol III has a dimer of the “core subunits”, which contain the polymerizing α subunits.CorePol III* complexFig. 21.17.“Clamps” subunit onto DNA, and makes it highly processive.Donut-shapedDimer.Fig. 21.15 in Weaver- Clamp – exists free and as subunit of Pol III holoenzymeFig. 21.16The effect of  subunit on the  clamp.Can the  clamp can slide off the end of linear DNA?Based on Fig. 21.13clampPlasmid DNA with nickAssay 1. Load clamp onto circular plasmid DNA.2. Treat DNA further.3. Separate DNA-bound clamp from free clamp.Fig. 21.11Blue – controlRed – treated with the indicated enzyme before chromatographyFirst peak = protein-DNA complexSecond peak = free  proteinBased on Fig. 21.13 f,gClamp sliding off the ends of linear DNA can be stopped by DNA binding proteins such as SSB and EBNA.Clamp will slide off SSB-coated DNA if it is part of the holoenzyme that is replicating DNA. Yellow line- control red line- experimentalSSB can retain clamp, but linearize again after loading SSB, clamp falls off. Load holoenzyme onto DNA with SSB, if all 4 dNTPs added, clamp falls off (control- only 1 or 2 dNTPs retains clamp)Pol III core dimer synthesizing leading & lagging strands. (tau) subunits (2) of Pol III bind to helicase. Clamp loading  complex of Pol III holoenzyme( ’, ,  ) 1. Uses ATP to open dimer and position it at 3’ end of primer.2. “Loaded” clamp then binds Pol III core (and releases from ).3. Processive DNA synthesis. - loads  subunit dimer onto DNA (at the primer) and Pol core (and unloads it at the end of Okazaki fragment) Order of events:Recycling phase 1. Once Okazaki fragment completed,  clamp releases from core.2. binds to 3. unloads clamp from DNA.4. clamp recycles to next primer.Figure 21.25Terminating DNA synthesis in prokaryotes.Fig. 21.26Each fork stops at the Ter regions, which are 22 bp, 3 copies, and bind the Tus protein.Decatenation of Daughter DNAsFig. 21.27Decatenation is performed by Topoisomerase IV in E. coli. Topo IV is a Type II topoisomerase: breaks and rejoins 2 strands of a duplex DNA.catenaneDNA replication in EukaryotesEukaryotic DNA polymerases (5):- has primase activity-elongates primers, highly processive, can do proofreading- DNA repair - DNA repair- replication of Mitochondrial (and/or Chloroplast DNA in plants)Eukaryotic DNA polymerases do NOT have 5' to 3' exonuclease activity. A separate enzyme, called FEN-1, is the 5' to 3' exonuclease that removes the RNA primers. Eukaryotes also have equivalents to the:Sliding clamp – PCNA (a.k.a. proliferating cell nuclear antigen)SSB – RP-A3'5'DA B CA' B' D'C'3'5'DA B CA' B' D'C'3'5'DA B CA' B' D'C'Problem for eukaryotes: Replicating the 5’ end of the lagging strand (because chromosomes are linear molecules)Gap generated by removal of the RNA primer3'5'DD'A B CA' B' C'3'5'DD'A B CA' B' C'Euk. chromosomes end with many copies of a special “Telomeric” sequence.Cells can lose some copies of the telomere w/out losing genes.(3 copies on this chromosome end)(Replication of this chromosome would produce 1 that is shorter by 1 telomere).GGG---GGGGGG3' HOCCC5' Ptelomere{GGG---CCC---DD'A B CA' B' C'5'3'Organism telomere repeatTetrahymena, Paramecium, Oxytricha (allare protozoa)T2G4Saccharomyces (yeast) (TG)1-3TG2-3Arabidopsis (plant) T3AG3Homo sapiens T2AG3Telomeres form an unusual secondary structure.Telomere Sequences5’ 3’Dashes are TsEnzyme that adds new telomeric repeats to 3’ ends of linear chromosomes.Diagram of how telomerase works.AAACCCAAAC3'5'GGGTTTGGGTTTGGGCCCAAACCC||||||||||||||||||3'5'Represents the RNA component of telomerase.Protein is not shown.Represents the end of a chromosome. You'v eseen this before.GGGTTTGGGTTTGGGCCCAAACCC||||||||||||||||||||||||3'AAACCCAAAC3'5'GGGTTTGGGTTTGGGTTTGCCCAAACCC||||||||||||||||||||||||||||3'AAACCCAAAC3'5'RNA component of telomerase base pairs withend of chromosome as shown.Telomerase synthesizes new DNA using the RNAcomponent as template.GGGTTTGGGTTTGGGTTTGCCCAAACCC||||||||||||||||||||||3'AAACCCAAAC3'5'GGGTTTGGGTTTGGGTTTGGGTTTGCCCAAACCC||||||||||||||||||||||||||||3'AAACCCAAAC3'5'Telomerase moves down and RNA componentbase pairs with end of telomere.Telomerase synthesizes new DNA using the RNAcomponent as template.Fig. 21.32Proteins bind the 3’ SS overhang for protection.More on the importance of Telomerase•Apoptosis - Cells are very sensitive to chromosome ends because they are highly recombinogenic. Telomeres don’t trigger apoptosis. •Aging - There are rapid aging diseases (e.g., Werner’s Syndrome) where telomeres are shorter than normal.•Cancer - Most somatic cells don’t have telomerase, but tumor cells do. Over-expression of telomerase in a normal cell, however, won’t turn it into a tumor cell. •Plants - Transgenic Arabidopsis with the telomerase gene turned off developed normally up to a point, then became sick.How is a Repl. origin selected? Priming at the oriC (Bacterial) OriginGGATCCTGgnTATTAAAAAGAAGATCTnTTTATTTAGAGATCTGTTnTATT Consensussequence GG . . .. A . . C Escherichia G GC . . .. T . . C Salmonella AG . . .. - . . C Enterobacter AG . . .. - . . T Klebsiella CGT A T GA T A C - Erwinia 13 9aGTGATCTCTTATTAGGATCGGnnntnnnnTGTGGATAAgnngGATCCnnnn Consensussequence.. CACTGCCC CAAG GGCT.. CGCCAGGC CCCG TGTA.. ACTCTCTA GTCG ACGA.. GCTTGTCT GTCA GCGGA-