CHAPTER 7 FROM DNA TO PROTEIN HOW CELLS READ THE GENOME 2009 Garland Science Publishing From DNA to RNA 7 1 RNA in cells differs from DNA in that a it contains the base uracil which pairs with cytosine b it is single stranded and cannot form base pairs c it is single stranded and can fold up into a variety of structures d the sugar ribose contains fewer oxygen atoms than does deoxyribose 7 2 Transcription is similar to DNA replication in that a an RNA transcript is synthesized discontinuously and the pieces are then joined together b it uses the same enzyme as that used to synthesize RNA primers during DNA replication c the newly synthesized RNA remains paired to the template DNA d nucleotide polymerization occurs only in the 5 to 3 direction 7 3 For each of the following sentences fill in the blanks with the best word or phrase selected from the list below Not all words or phrases will be used use each word or phrase only once For a cell s genetic material to be used the information is first copied from the DNA into the nucleotide sequence of RNA in a process called Various kinds of RNA are produced each with different functions molecules code for proteins molecules act as adaptors for protein synthesis molecules are integral components of the ribosome and molecules are important in the splicing of RNA transcripts incorporation mRNA pRNA translation 7 4 rRNA snRNA transcription Match the following structures with their names transmembrane tRNA proteins Figure Q7 4 7 5 Which of the following statements is false a A new RNA molecule can begin to be synthesized from a gene before the previous RNA molecule s synthesis is completed b If two genes are to be expressed in a cell these two genes can be transcribed with different efficiencies c RNA polymerase is responsible for both unwinding the DNA helix and catalyzing the formation of the phosphodiester bonds between nucleotides d Unlike DNA RNA uses a uracil base and a deoxyribose sugar 7 6 Which one of the following is the main reason that a typical eucaryotic gene is able to respond to a far greater variety of regulatory signals than a typical procaryotic gene or operon a Eucaryotes have three types of RNA polymerase b Eucaryotic RNA polymerases require general transcription factors c The transcription of a eucaryotic gene can be influenced by proteins that bind far from the promoter d Procaryotic genes are packaged into nucleosomes 7 7 Match the following types of RNA with the main polymerase that transcribes them 7 8 List three ways in which the process of eucaryotic transcription differs from the process of bacterial transcription 7 9 For each of the following sentences fill in the blanks with the best word or phrase selected from the list below Not all words or phrases will be used each word or phrase should be used only once In eucaryotic cells general transcription factors are required for the activity of all promoters transcribed by RNA polymerase II The assembly of the general transcription factors begins with the binding of the factor to DNA causing a marked local distortion in the DNA This factor binds at the DNA sequence called the box which is typically located 25 nucleotides upstream from the transcription start site Once RNA polymerase II has been brought to the promoter DNA it must be released to begin making transcripts This release process is facilitated by the addition of phosphate groups to the tail of RNA polymerase by the factor It must be remembered that the general transcription factors and RNA polymerase are not sufficient to initiate transcription in the cell and are affected by proteins bound thousands of nucleotides away from the promoter Proteins that link the distantly bound transcription regulators to RNA polymerase and the general transcription factors include the large complex of proteins called the The packing of DNA into chromatin also affects transcriptional initiation and histone is an enzyme that can render the DNA less accessible to the general transcription factors activator CAP deacetylase enhancer 7 10 lac ligase mediator TATA TFIIA TFIID TFIIH You have a piece of DNA that includes the following sequence 5 ATAGGCATTCGATCCGGATAGCAT 3 3 TATCCGTAAGCTAGGCCTATCGTA 5 Which of the following RNA molecules could be transcribed from this piece of DNA a b c d 7 11 5 UAUCCGUAAGCUAGGCCUAUGCUA 3 5 AUAGGCAUUCGAUCCGGAUAGCAU 3 5 UACGAUAGGCCUAGCUUACGGAUA 3 none of the above You have a segment of DNA that contains the following sequence 5 GGACTAGACAATAGGGACCTAGAGATTCCGAAA 3 3 CCTGATCTGTTATCCCTGGATCTCTAAGGCTTT 5 If you know that the RNA transcribed from this segment contains the following sequence 5 GGACUAGACAAUAGGGACCUAGAGAUUCCGAAA 3 Which of the following choices best describes how transcription occurs a The top strand is the template strand RNA polymerase moves along this strand from 5 to 3 b The top strand is the template strand RNA polymerase moves along this strand from 3 to 5 c The bottom strand is the template strand RNA polymerase moves along this strand from 5 to 3 d The bottom strand is the template strand RNA polymerase moves along this strand from 3 to 5 7 12 Which of the following molecules of RNA would you predict to be the most likely to fold into a specific structure as a result of intramolecular base pairing a b c d 7 13 5 CCCUAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUAGGG 3 5 UGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUG 3 5 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 3 5 GGAAAAGGAGAUGGGCAAGGGGAAAAGGAGAUGGGCAAGG 3 Imagine that an RNA polymerase is transcribing a segment of DNA that contains the following sequence 5 AGTCTAGGCACTGA 3 3 TCAGATCCGTGACT 5 A B 7 14 If the polymerase is transcribing from this segment of DNA from left to right which strand top or bottom is the template What will be the sequence of that RNA be sure to label the 5 and 3 ends of your RNA molecule The sigma subunit of bacterial RNA polymerase a contains the catalytic activity of the polymerase b remains part of the polymerase throughout transcription c recognizes promoter sites in the DNA d recognizes transcription termination sites in the DNA 7 15 Which of the following might decrease the transcription of only one specific gene in a bacterial cell a a decrease in the amount of sigma factor b a decrease in the amount of RNA polymerase c a mutation that introduced a stop codon into the DNA that precedes the gene s coding sequence d a mutation that introduced extensive sequence changes into the DNA that precedes the gene s transcription