Gene to Protein part 2 Transcription and translation Mutations 1 Learning goal for genes unit Students will understand and make predictions about how the information in a gene is accessed for expression of a specific protein Focus Transcription and translation review What is a mutation 2 Connections phenotype and genotype Genes are Alleles are Genotype is Phenotype is Previous concepts polymer primary structure protein folding enzymes 3 Central dogma mRNA proteins DNA information storage transcription mRNA information carrier translation protein active cell machinery 4 A gene is the instructions for the primary structure of one protein subunit polypeptide DNA protein 4 unique nucleotides CATG 20 unique amino acids 5 LC is this strand shown in red the gene s CODING strand or TEMPLATE strand Template 3 to 5 Coding strand is 5 to 3 6 7 Protein works Protein misfolded 8 Alleles variations in a gene sequence different phenotypes all of the alleles that Mendel followed all of the alleles that we will discuss in chapters 12 and 13 all of the heritable variations in human and animal populations They are variations in DNA sequence that change proteins function or level of expression BB bb 9 B version of this gene b version of this gene both genes make working proteins both genes make broken proteins BB bb 10 The phenotype is what we can see or measure based on the expression of the genotype One gene one phenotype No There are over 100 genes that affect the pigmentation patter in mice Enzyme proteins that create colorful molecules through metabolic pathways Transcription factor proteins that control in which cells these genes will be turned on Transporter proteins that deposit the colors onto fur in different amounts We will focus on phenotypes that are dependent upon one gene Metabolic pathways for example A Enz 1 B Enz 2 C Enz 3 D In this example it takes three working enzymes to create D from A But even this gets complicated Some enzymes are heterodimers or heterotrimers This means that the complete enzyme depends on two or more different genes Diploid creatures have two alleles of every gene Is one working copy enough or do both have to work Transcription and translation DNA coding strand 5 TGATGAAATATGTATGTATGATATGA 3 3 ACTACTTTATACATACATACTATACT 5 template strand We refer to the strand with the protein coding information as the coding strand We refer to the other strand of the gene as the template Your book often puts the template strand on top I might not 13 Transcription of a gene occurs in the nucleus the gene coding strand 5 TGATGAAATATGTATGTATGATATGA 3 the gene RNA copy mRNA copy of coding strand 5 UGAUGAAAUAUGUAUGUAUGAUAUGA 3 3 ACTACTTTATACATACATACTATACT 5 template strand 14 Translation occurs in the cytoplasm 5 UGAUGAAAUAUGUAUGUAUGAUAUGA 3 M First AUG from the 5 end START WITH THE START Transcription begins at the start codon which is always AUG Thus every protein starts with methionine Nucleotides before the start codon will not be translated 15 Translation occurs in the cytoplasm 5 UGAUGAAAUAUGUAUGUAUGAUAUGA 3 M GO BY THREES Translation proceeds by moving three nucleotides at a time 16 Translation of an mRNA 5 UGAUGAAAUAUGUAUGUAUGAUAUGA 3 M K Y V C M The ribosome continues to the next three nucleotides I Each group of three nucleotides is called a codon I will always give you this table on an exam 17 Translation of an mRNA 5 UGAUGAAAUAUGUAUGUAUGAUAUGA 3 M K Y V C M I STOP AT THE STOP When we reach a stop codon translation is over Additional nucleotides beyond the stop codon will not be translated 18 Translation of an mRNA M K Y V C M I Tell me about what we ve created here What is it What happens next A polypeptide is created and starts to fold in to secondary and tertiary structures 19 Mutations changing DNA changes the protein Point mutations alter a single nucleotide Effects on primary protein structure and function will vary 5 UGAUGAAAUAUGUAUGUAUGAUAUGA 3 M K Y V C M I STOP 20 Mutations changing DNA changes the protein Types of POINT mutations Silent mutation no change in protein primary sequence 5 UGAUGAAAUAUGUAUGUAUGAUAUGA 3 G M K Y V C M I STOP 21 Mutations changing DNA changes the protein Types of POINT mutations Missense switching one amino acid with another conservative and non conservative 5 UGAUGAAAUAUGUAUGUAUGAUAUGA 3 G M R K Y V C M I STOP 22 Mutations changing DNA changes the protein Types of POINT mutations Nonsense premature end truncation 5 UGAUGAAAUAUGUAUGUAUGAUAUGA 3 A M K STOP Y V mutation C M I STOP nonsense TRUNCATED protein 23 Mutations changing DNA changes the protein Types of POINT mutations Frame shift Insertion or deletion of one or two base pairs that alters all subsequent codons 5 UGAUGAAAUAUGUAUGUAUGAUAUGA 3 M K M K Y V L C Y M I V Alters the entire sequence after the affected area 24 The effects of a substitution on protein folding function depend on what it changes and how More likely to be deleterious mutation if it hits active site disulfide bridge cysteine anchor point 3 or 4 structure any residue required for direct interaction with anything else 25 The effects of a substitution on protein folding function depend on what it changes and how More likely to be deleterious mutation if it CHANGES R group size R group chemical properties 26 The effects of a substitution on protein folding function depend on what it changes and how Single amino acid change WHERE location where enzyme interacts its substrate via ionic bond WHERE location between active sites unimportant to function WHAT change from large charged to small nonpolar WHAT change from medium polar to medium polar EFFECT enzyme is likely to be ruined conservative 27 Which of the following mutations would probably destroy the protein A B C D E F G H I A nonsense mutation in the middle of the coding region A nonsense mutation after the stop codon A point mutation that changes the starting AUG to AGG A point mutation that changes the stop codon to AGG A conservative missense mutation in a noncritical region A nonconservative missense mutation in a noncritical region A silent mutation in the active site The insertion of a single base pair just before the start codon The insertion of a single base pair just after the start codon Remember that the ribosome is a machine and follows rules Deduce what effect each mutation would have on translation and decide if it will affect the protein 28 You should be able to Understand and apply the central dogma properties of the genetic code 1 2 Explain