Slide 1Slide 2Slide 3Slide 4Slide 5Slide 6Slide 7Slide 8Slide 9Slide 10Slide 11Slide 12Slide 13Slide 14Slide 15Slide 16Slide 17Slide 18Slide 19Slide 20Slide 21Slide 22Slide 23Slide 24Conventions commonly encountered in human pedigreesSlide 26Slide 27Slide 28Slide 29Slide 30Slide 31Slide 32Slide 33Slide 34Slide 35Slide 36Slide 37Slide 38Slide 39Slide 40Slide 41Slide 42Slide 43Slide 441Biology 240 - General GeneticsSpring 2015Dr. Joe WilliamsContact: 974-6202, [email protected], January 27thUnless otherwise indicated, photo credits are from:A. Klug WS, Cummings MR, Spencer CA, Palladino MA, Killian D. 2014. Concepts of Genetics. Boston: Pearson.B. Griffiths, S. Wessler, R. Lewontin, and S. Carroll. 2008. Introduction to Genetic Analysis, Eighth Edition. W. H. Freeman & Company.2Get involved with Darwin day!1009080706050403020100051015202530354045Quiz #1Percentage correctNum ber of students3Average = 73%About ½ of classgot 80% or better45p10 unitssufficient 0“p”P 0“P”10 unitsinsufficientThese are threshold traits - discontinuousRecessive DominantThe same mutation can be either recessive or dominant it all depends on how two alleles function togetherA loss-of-function mutation6p10 unitssufficient 0“p”P 0“P”10 unitsinsufficientFor example, a mutated regulatory gene that causes a gene to become permanently switched on.Proto-oncogenes become oncogenes (cancer)Recessive Dominant Dominant“p”P 10++ units10 unitsOversufficientWay too muchproductDominant mutations are often gain-of-function mutationsHow do dominant mutations work? A wild type allele is expressed only at the appropriate level and stage of development (time).A mutated allele that is dominant will be expressed at higher levels (makes more protein) and/or at inappropriate times. The hyperactive mutated allele will mask the wild type allele when they occur together in a heterozygote.8Incomplete, or partial dominance = both allelesinfluence expression in the heterozygote9What happens when 2 alleles are together in heterozygote?Incomplete dominanceP P10 units producedPp5 units producedp p0 units produced 5 0 0 0or 5 5p = mutant with: loss of functionDefault expression is white = no pigment produced10What happens when 2 alleles are together in heterozygote?Incomplete dominanceP P20 units producedPp10 515 units producedp p5 510 units produced10 10Just as in the “knock-out” or loss-of-function mutation, the alleles “interact” to produce a quantitative phenotypep = mutant with: reduced function11What happens when 2 alleles are together in heterozygote?Incomplete dominance – dosage effectP P20 u. producedPp10 515 units producedp p5 510 units produced10 10But here, both alleles have some expression:the mutation just reduces the expression level of one allele12ABO blood group genes13Codominance = equal expression of allelesGenotype Blood typeIAIA, IAi AIBIB, IBi BIAIB ABii OFunction to produce cell-surface molecules:IA determines presence of antigen AIB determines presence of antigen Bi cannot produce an antigenCodominantA, B dominant to ii is a null allele© 2015 Pearson Education, Inc.Biochemical pathwaysfor ABO blood groupsii, or O blood typeIAIA, IAiIBIB, IBi© 2015 Pearson Education, Inc.Biochemical pathwaysfor ABO blood groupsii, or O blood typeIAIA, IAiIBIB, IBiRare O:Bombayphenotype…mutation in a different gene16The degree of “dominance” depends on what biological level the phenotype is measured With respect to the phenotype:Anemia - HbA is fully dominant due to haplosufficiency (HbA/- not anemic)Blood cell sickling - HbS is partially dominant, some blood cells sickle in HbA HbS, many sickle in HbS HbSSickle cell anemia17The degree of “dominance” depends on what biological level the phenotype is measured If phenotype = mobility on a gel, then codominant: both alleles equally visible on gel18The type of dominance is determined by the molecular functions of the alleles of a geneand by the investigative level of analysisHbA – Full dominance with respect to AnemiaHbS – Partial dominance with respect to sickled cellsBoth alleles – Codominant with respect to production of their specified protein, seen by electrophoresisMessage: a mutation in itself does not have some degree of dominanceThe traits that it affects determine the dominance level19Allelic series in white cloverSeven alleles have varying effects (and dominance relationships)on the chevron patternThere may be many different alleles in a populationGeneGenes differ by mutations of their DNA sequence:Normal alleleAlbinism allele = single nucleotide difference causes abrupt termination of transcription of mRNAChromosome…acctaggtcttggata……acctacgtcttggata…“tac” means produce the amino acid tyrosine;“tag” means STOP!Any difference in DNA sequence within the gene creates a new allele but not all mutations cause a change in protein or ultimate morphology…acctatgtcttggata… “tat” also produces tyrosineatggctacctggtacctgcctgat………..cctacgctgcgtaatggactagcttagA gene is made up of a linear sequence of DNA basesStart site:Stop site:taccgatggaccatggacggacta………ggatgcgacgcattacctgatggaatcComplementary sequenceatggctacctggtacctgcctgat………..cctacgctgcgtaatggactaccttagA gene is made up of a linear sequence of DNA basesAn allele is any difference in DNA sequence, if it is detectedatggctacctgctacctgcctgat………..cctacgctgcgtaatggactaccttagatggctacctggtacctgcctgat………..cctaggctgcgtaatggactaccttagatggctaccaggtacctgcctgat………..cctacgctgcgtaatggactaccttagatggctacctggtacctgcctgat………..cctacgctgcgttatggactaccttagatggctacctgctacctgcctgat………..cctacgctgcgttatggactaccttagatggctacctgctacctgcctgat………..ccttcgctgcgtcatggactaccttagatggctacctggtacctgcctgat………..cctacgctgcgtcatggacaaccttagatggctacctggtacctccctgat………..ccttcgctgcgtaatggactaccttag1234567891010 alleles detected at the gene level…but only 2 alleles at thephenotypic levelPPPpPPPPP23There may be many different alleles in a