Chapter 1 I LIFE S HIERARCHICAL ORDER A Each level of biological order is built on a simpler level Ecosystems Communities B io s p h e r e Populations Organisms Organ Systems Organs Tissues Cells Organells Molecules Atoms Biological hierarchy Ecosystem an ecosystem consists of all living things in a particular area along with all the nonliving components of the environment with which life interacts such as soil water atmospheric gases and light All of Earth s ecosystems combined make up the biosphere Community populations of many different species the entire array of organisms inhabiting a particular ecosystem Population collection of organisms of same breeding species consists of all the individuals of a species living within the bounds a specified area the set of populations that inhabit a particular area Organism individual living things are called organisms Organ System combined organs for specific task Digestion teeth stomach liver etc Organs several tissues combined that function together stomach Tissues groups of cells with coordinated function each tissue has a specialized cellular structure Cells life s fundamental unit of structure and function instead of a single cell performing all the functions of life a multicellular organism has a division of lab or among specialized cells one cell is only about 40 micrometers um across Organelles various functional components present in cells Molecules chemical structure consisting of tow or more small chemical units called atoms Atoms make up molecules B New emergent properties materialize at each level of hierarchy Emergent Properties unique properties that occur going from one level to the next novel properties emerge at each step properties that aren t present at the preceding level emergent properties are due to the arrangement and interactions of parts as complexity increases emergent properties aren t unique to life 1 The interaction of components on the same level creates novel properties Whole is greater than sum of parts Eg atomic to molecular H2 O2 H2O water H2 O2 H2O2 hydrogen peroxide Both molecules comprised of only hydrogen and oxygen but have unique properties based on how the hydrogen and oxygen molecules interact with each other Eg organism level organ to organ system teeth stomach intestines etc digestion of food 2 Emergent properties associated with life a order everything has order characterizes life b reproduction organisms living things reproduce their own kind c hereditary programs DNA most important gives organisms the ability to pass information to generations d evolutionary adaptation adaptations evolve over many generations by the reproductive success of those individuals with heritable traits that are best suited to their environments e energy processing utilization chemical energy stored in food gives organisms the power to work i energy is removed from the environment and ii converted to usable form to maintain order a f ability to respond to environmental stimuli g homeostasis maintenance of internal order when external environment changes all interactions contribute to the organism C Cell The basic unit of structure and function 1 Cell theory all cells come from pre existing cells Cell smallest unit of structural function life s fundamental unit of structure and function Every cell is enclosed by a membrane that regulates the passage of materials between the cell and its surroundings and every cell uses DNA as its genetic information 2 There are 2 main cell types Two main forms of cells prokaryotic and eukaryotic The cells of two groups of organisms called bacteria and archaea are prokaryotic All other forms of life including plants and animals are eukaryotic A eukaryotic cell is subdivided by internal membranes into various membrane enclosed organelles In most eukaryotic cells the largest organelle is the nucleus which contains the cell s DNA The other organelles are located in the cytoplasm the entire region between the nucleus and the outer membrane of the cell Prokaryotic cells are much simpler and generally smaller than eukaryotic cells In a prokaryotic cell the DNA isn t separated from the rest of the cell by enclosure in a membrane bounded nucleus Prokaryotic cells also lack the other kinds of membraneenclosed organelles that characterize eukaryotic cells The properties of all organisms are based in the structure and function of cells a prokaryotic b eukaryotic plasma membrane plasma membrane no membrane enclosed nucleus yes no membrane enclosed organelles yes bacteria only protists plants fungi animals rigid tough external cell wall plants have cell wall small 1 10 m larger 10 100 m 10X larger Most important characteristic D DNA conveys information between generations The division of cells to form new cells is the foundation for all reproduction and for the growth and repair of multicellular organisms Chromosomes have almost all of the cell s genetic material its DNA short for deoxyribonucleic acid DNA is the substance of genes the units of inheritance that transmit information from parents to offspring 1 Structure a 4 nucleotides building blocks Adenine Thymine Guanosine Cytosine b 2 3 D shape double helix Function a the linear sequence of nucleotides encodes precise information TAGCATTCGATCAAGGCCCTATTCCAAGGCCCTTTCGATCAACATTCGATCA gene 1 gene 2 gene 3 gene 4 4 genes on this chromosome example b genes encode everything about the organism c inheritance is the copying and passing on of genes d universal alphabet for ALL organisms bacteria to humans e physical differences reflect differences in nucleotide sequences Each chromosome contains one very long DNA molecule with hundreds or thousands of genes arranged along its length The genes encode the information necessary to build other molecules in the cell most notably proteins Proteins play structural roles and are also responsible for carrying out cellular work They thus establish a cell s identity The DNA of chromosomes replicates as a cell prepares to divide and each of the two cellular offspring inherits a complete set of genes identical to that of the parent cell Each of us began life as a single cell stocked with DNA inherited from our parents Replication of that DNA with each round of cell division transmitted copies of the DNA to our trillions of cells The DNA controls the development and maintenance of the entire organism and indirectly everything that the organism does The DNA serves as a central database Each DNA molecule is made