BSCI 410 Molecular Genetics Review material for the first exam.Lectures 1-11 Review and Preview Exam will be Friday, March 7, 2003-------------------------------------------------------------------------------------------------------------Study material:The exam will be held on Friday, March 7, 2003. This is the original date on the syllabus.The exam will cover material originally scheduled for lectures 1-11 (i.e. sections I, II and IIIA).This is one less lecture than stated in the syllabus (Prokaryotic transcription will not be coveredin consideration of the lectures missed due to snow).The readings are essentially what is specified in the syllabus:Hartwell Chs. 1-9, 12 and 24; Fig. 15.14; pp. 461-471 and pp. 756-759.This review is designed to help you focus on what's important.You probably want to consult exams from earlier years (available online) as well.We have not covered everything in all of the chapters, and you are not generally responsible fortopics that were completely skipped in class.Terms and concepts. I may simply ask for a definition of a given term, or I may devise aquestion that tests whether you understand the meaning of the term or concept.Saccharomyces cerevisiaeCaenorhabditis elegansDrosophila melanogasterArabidopsis thalianaMus musculustRNAmRNArRNAprimertemplatetranscriptiontranslationexonintronmitosismeiosisprophasemetaphaseanaphasehaploiddiploidmicrofilamentsmicrotubulescentriolecentromeresister chromatidhomologsemidominantcodominantamorphnullhypomorphhypermorphneomorphantimorphhaploinsufficiencycloninghostvectorBACYACcosmidSouthern blotnorthern blotwestern blotfootprintgel shiftmicroarraypseudogenesLINESSINESsatellite DNAL1Aluretrotransposonsretroviruslike transposableelementstarget site duplicationsterminal inverted repeats.Review:Be able to look at a human pedigree showing an inherited trait and indicate whether it showsautosomal dominant, autosomal recessive, X-linked recessive, X-linked dominant, maternal(mitochondrial), or Y-linked inheritance.Be able to use the Hardy-Weinberg equation to 1) calculate the frequency of carriers from thefrequency of affected individuals. 2) calculate the frequency of affected individuals from thefrequency of carriers or from the allele frequency 3) determine from the frequency of variousgenotypes whether or not alleles at a locus are in Hardy-Weinberg equilibrium.BSCI 410 Molecular Genetics Review material for the first exam.Lectures 1-12 Review and Preview Exam will be Friday, March 7, 2003-------------------------------------------------------------------------------------------------------------Be able to predict the outcome of a monohybrid cross and a dihybrid cross. Be able to calculaterecombination frequency from the results of a two-factor or three-factor cross and obtain thegene order from a three-factor cross. Be able to predict the results of unordered tetrad analyses(see problems 4-22 and 4-23 in Hartwell for practice). If two yeast genes are on differentchromosomes and neither is linked to a centromere, what do you expect the ratio of PD, NPDand T tetrads to be?Be able recognize the chemical structure for each of the four bases and each of the 20 amino acidside chains. Be familiar with the single-letter amino acid code. Be familiar with the prefixesato- through peta-Be prepared to compare and contast DNA footprinting and gel-shifts (EMSA, or electrophoreticmobility shift assays).Be able to describe the various classes of dispersed repeated element (transposable elements)found in eukaryotic genomes.Problems: Be able to answer questions like the following.1. Here is the sequence of the template strand of a DNA fragment:5' TTGTAACTCTAGGTACCTACCTGTATTTAACTG 3'Which of the following would be the complementary, nontemplate, strand:a) 5' CAGTTAAATACAGGTAGGTACCTAGAGTTACAA 3'b) 5' GTCAATTTATGTCCATCCATGGATCTCAATGTT 3'c) 5' TTGTAACTCTAGGTACCTACCTGTATTTAACTG 3'd) 5' AACATTGAGATCCATGGATGGACATAAATTGAC 3'2. (Label each of the following six statements as true or false.a) Sister chromatids (products of the replication of a single chromosome) separate at mitosis.b) Sister chromatids separate at the first meiotic division.c) Sister chromatids separate at the second meiotic division.d) Homologs separate at mitosis.e) Homologs separate at the first meiotic division.f) Homologs separate at the second meiotic division.3. In shorthorn cattle, the genotype RR causes a red coat, the genotype rr causes a white coat, andthe genotype Rr causes a roan coat. A breeder has red, white and roan cows and bulls. Whatphenotypes might be expected from the following matings, and in what proportions.a) red X redb) red X roanc) red X whited) roan X roan4. If both husband and wife are known to be carriers of the allele for albinism, what is the chanceof each of the following combinations in a family of two children. (this is not multiple-choice).a) Both normalb) one normal and one albinoc) both albino5 You have a piece of DNA that includes the sequence:BSCI 410 Molecular Genetics Review material for the first exam.Lectures 1-12 Review and Preview Exam will be Friday, March 7, 2003-------------------------------------------------------------------------------------------------------------5' - AGTACCATGTACCTGTACCTGTACTATCTATCGGGTGACTGCTTATCCG - 3'To amplify this DNA by PCR you would use which of the following pairs of primers:a) 5' - AGTACCATGTACCTG - 3' and 5' - GTGACTGCTTATCCG - 3'b) 5' - CAGGTACATGGTACT - 3' and 5' - CGGATAAGCAGTCAC - 3'c) 5' - CAGGTACATGGTACT - 3' and 5' - GTGACTGCTTATCCG - 3'd) 5' - AGTACCATGTACCTG - 3' and 5' - CGGATAAGCAGTCAC - 3' (Note. There will be a question like this on at least one exam this term)6. Chickens that carry both the alleles for rose comb (R) and pea comb (P) have walnut combs,while chickens that lack both of those alleles (that is, they are genotypically rr pp) have singlecombs. Rose-combed chickens mated with pea-comb chickens produced 21 walnut chicks and23 rose chicks. What is the genotype of the parents?7. Polynucleotide kinase can be used to label which end of a DNA strand (the 5' end or the 3'end) with 32P?8. In the following molecule, which end (left or right) has a 5' overhang?5' AAGGGTGGCAATGCATGGCGGTTAGTGCCTCTAGCACTAATGG 3'3' CCCACCGTTACGTACCGCCAATCACGGAGATCGTGATTA 5'9. If you were to use polynucleotide kinase to label DNA with 32P, which nucleotide would youwant to use:a) dATP labeled in the alpha position.b) ATP labeled in the alpha position.c) dATP