BIOL 1050 Lecture 17 Outline of Last LectureI. Human health usesII. Better medicinesIII. DNA technology used to make vaccinesIV. Gene therapy to cure diseasesV. Gene therapyVI. Difficulties with gene therapyVII. Biotech to prevent diseasesVIII. Agricultural issuesOutline of Current LectureI. DNA fingerprintingII. Creating a DNA fingerprintIII. Cloning Current LectureI. DNA fingerprintinga. Used to see if two DNA samples are from the same person (or closely related individuals)b. 99.9% of DNA sequences between 2 individuals are the samei. Approximately 3 million base pairs differc. Fingerprinting focuses on 13 or more variable parts of DNA, i.e. STRsi. STR=Short tandem repeats (repeating sequence 4 or 5 nucleotides long)d. Have two copies of each STRsi. One from each parentii. Number of repeats of each copy can differ= allele1. Variable parts of the DNA are allelesa. Allele is an alternative form of gene (same gene, different product based on DNA)iii. Example of STRa. ATGCATGCATGCTGCATGCATGCe. Probability of having the same STR allele at a single location on one chromosomei. 1 in 10 (10% of population) (1/10 that two people will share 1 similar allele)f. One copy of STR allele from each parenti. 1 in 100 (1% of population) (1/100 that two people will share two alleles)g. Probability of two STR alleles at two different locations from each parentThese notes represent a detailed interpretation of the professor’s lecture. GradeBuddy is best used as a supplement to your own notes, not as a substitute.i. 1 in 10,000 (.01% of population) (1/10000 that they will share 4 alleles)h. FBI’s combined DNA index system (codis) i. 1 in 10^26(more people than there are on earth) probability that two individuals will share the same DNA unless they are twins II. Creating a DNA fingerprinta. A DNA fingerprint is created by determining which alleles an individual carries for 13 different STR locib. Gel electrophoresis sorts fragments based on their length and electrical chargei. For each of the 13 STR loci used to construct an individual’s DNA fingerprint, the DNA fragment containing each STR region is amplified usingPCR, resulting in huge numbers of those fragments. The amplified DNA fragments differ in size, depending on how many times the repeating unit of that STR is repeatedii. The amplified DNA fragments are separated by size using electrophoresis. In this process, DNA fragments are poured into a solution and an electrical charge is applied. Because DNA is a negatively charged molecule, the piecesof DNA move toward the positively charged electrode. Smaller pieces- those with fewer repeats- move more quickly than larger pieces.iii. Computer software is used to analyze the results. The number of repeats within an STR region (indicating an individual’s genotype) is determined by comparing the length of the fragments containing that STR region to DNA fragments of known lengthsiv. DNA fragments are stained1. The bands of different DNA samples can then be comparedc. Uses for technologyi. DNA fingerprinting can be used to1. Investigate crimes2. Test paternity3. Identify remains of the dead4. Tell if a product comes from an endangered species5. Study evolution III. Cloninga. Cloning can be done in lab by nuclear transferi. Nuclear transfer: replacing the nucleus of an egg cell with a different nucleus from specialized cell from a different individualii. Only one parent, but divides to become embryo1. Can use this early embryo fora. Whole organism cloningb. Therapeutic cloningi. The creation of embryonic stem cells for medical useiii. Very difficult process, requires very steady handiv. Dolly the cloned sheep had 250-300 attempts before it was successful v. Process of cloning1. Isolate an egg cell from one (sheep) and a mammary cell from another. Remove the nucleus from the egg cell2. Fuse the mammary cell, including its nucleus, with the egg cell3. Initiate cell division4. Grow the embryo in culture5. Transplant the embryo into the womb of a surrogate mother sheep6. Surrogate mother gives birth to cloned sheep vi. Cloning can be beneficial as a food source1. If a particular cow makes lots of good milk, that cow can be cloned for even more milk production vii. Dolly died prematurely because they used an adult cell that could no longerdivide and mutate and did not have telomerase gene (started out with shorter DNA)1. Could increase longevity of a clone by using younger embryonic cellsviii. Therapeutic cloning1. More beneficial to humans from an ethical standpoint2. Processa. Nucleus from donor cellb. Early embryo resulting from nuclear transplantationc. Remove embryonic stem cells from embryo and grow in cultured. Induce stem cells to form specialized cells for therapeutic use3. There has been success in this area4. Problem- knowing right ingredients to put in order to make the cells become certain things (how to get a heart cell vs. a liver cell)ix. No documented cases of whole humans cloned yetx. New organs have been grown using cells from adult