1. Below is a partial sequence of a transcribed region of DNA. The sequence corresponds to the non-template strand of DNA. A) What polypeptide would result from this strand? B) Assume that a transition mutation occurs at nucleotide 26 (nucleotide 26 is bold and underlined). Would this mutation be a missense, nonsense, or silent mutation? Explain your answer.…..GCCATAGCTATGCCCCTAATTATTGCGATGGTA…..2. Is the mutation above more likely to have come from a chemical mutagen such as nitrous oxide or a base analog, or from a chemical mutagen such as ethidium bromide or acridine orange dyes? Explain your answer.3. Below is a partial sequence of the human insulin gene. The sequence corresponds to the non-transcribed, or partner, strand. A) What polypeptide would result from this strand? B) Assume that a transition mutation occurs at nucleotide 23 (nucleotide 23 is bold and underlined). Would this mutation be a missense, nonsense, or silent mutation? D) What possible affects could this kind of mutation have on the insulin gene product?…..GCAGCCTTTGTGAACCAACACCTGTGCGGCTCACAC…..4. Is the mutation above more likely to have come from a chemical mutagen such as nitrous oxide or a base analog, or from a chemical mutagen such as ethidium bromide or acridine orange dyes? Explain your answer.E. coli cells grown on bacterial growth media containing the thymine analogue 5’-bromo-uracil have a high rate of transition mutations. Discuss the mechanism by which 5’-bromo-uracil increases the rate of mutation in E. coli. Explain why 5’-bromo-uracil results in more transition mutations than in transversion mutations.Describe the difference between a DNA mutation caused by an alkylating agent like mustard gas and an intercalating agent such as ethidium bromide. Explain which type of mutation might cause the most harm and support this by an illustration or description.Describe how any one of the following mutagens can cause mutations and the potential outcome of such amutation: 5-bromouracil, ethidium bromide, nitrous oxide, ultraviolet light, x-rays, mustard gas.What DNA repair mechanism is most likely to be used to fix the problems associated with the mutagen you chose above?1. Histone genes are unusual because they lack introns. Following is a partial sequence of the non-template (or partner) strand of a tobacco histone gene. a. What polypeptide would result from this strand? b. Assume that a transition mutation occurs at nucleotide 30 (nucleotide 30 is bold and underlined). Would this mutation be a missense, nonsense, or silent mutation? Explain your answer.c. What are the possible consequences of this type of mutation on the histone protein?…TTAGAAAGATGTCGGCAACTGGAAAAGTGGAGAGCTCCGCCGTGG……2. Is the mutation above more likely to have come from a chemical mutagen such as nitrous oxide or a base analog, or from a chemical mutagen such as ethidium bromide or acridine orange dyes? Explain your answer.5. (Imagine) the following is a partial sequence of the hemoglobin gene in Homo sapiens. The sequence corresponds to the template, or transcribed strand, of the DNA. d. What polypeptide would result from this strand? …GCCTGGGGTATAGCTAGGAGCAAGTTCAGATCA……e. Assume that the nucleotide base T were inserted after the underlined G base resulting in the following strand. What is the new amino acid? …GCCTGGGGTATAGCTAGGAGTCAAGTTCAGATCA……f. Would this mutation be a missense, nonsense, or silent mutation? Explain your answer.g. Is it more likely that this mutation is the result of an intercalating agent like ethidium bromide or an alkylating agent like mustard gas? Explain your answer.h. What is the potential phenotypic consequence of such a mutation?1. Below is a partial sequence of the human insulin gene. The sequence corresponds to the template, or transcribed strand, of the DNA. A) What polypeptide would result from this strand? B) Assume that a transition mutation occurs at nucleotide 23 (nucleotide 23 is bold and underlined). Would this mutation be a missense, nonsense, or silent mutation? D) What possible affects could this kind of mutation have on the insulin gene product?…..GCAGCCTTTGTGAACCAACACCTGTGCGGCTCACAC…..3. Is the mutation above more likely to have come from a chemical mutagen such as nitrous oxide or a base analog, or from a chemical mutagen such as ethidium bromide or acridine orange dyes? Explain your answer.1. Below is a partial sequence of a transcribed region of DNA. The sequence corresponds tothe non-template strand of DNA. a. What polypeptide would result from this strand (the genetic code is on the cover page)? b. Assume that a transition mutation occurs at nucleotide 26 (nucleotide 26 is bold and underlined). Would this mutation be a missense, nonsense, or silent mutation?Explain your answer.c. What are the possible consequences of this type of mutation? …..GCCATAGCTATGCCCCTAATTATTGCGATGGTAAGCAAA…..5. Following is a partial sequence of the myocardin gene in Homo sapiens. The sequence corresponds to the non-template, or partner strand, of the DNA. i. What polypeptide would result from this strand? j. Assume that a transition mutation occurs at nucleotide 31 (nucleotide 31 is bold and underlined). Would this mutation be a missense, nonsense, or silent mutation? Explain your answer.k. What are the possible phenotypic consequences of this type of
View Full Document