Cells Part IIIDNA ReviewSlide 3Significance of DNA StructureDNA ReplicationEnzymes of DNA ReplicationSlide 7Slide 8Slide 9Central Dogma of Molecular BiologyGene – Protein ConnectionRNATypes of RNATranscription: DNA -> RNAReading the MessageSlide 16Translation: mRNA -> ProteinSlide 18Slide 19Cells Part IIIDNA Review•Nucleic acid•Double stranded helix•Monomer – nucleotide•Nucleotide – phosphate, deoxyribose sugar, nitrogenous base•Sugar phosphate backbone formed through bonds – what kind?•Each sugar attaches to 2 Phosphate confers directionality.•Nitrogenous bases interact via bond – what kind? Strong or weak?•www.ncbi.nlm.nih.gov/.../MolBioReview/dna2.htmDNA Review•A-T, C-G which are purines, which are pyrimidines?•Antiparallel orientation•Torsion in helix and stacking of bases produce major and minor groovesghr.nlm.nih.gov/.../illustrations/dnastructureghr.nlm.nih.gov/.../illustrations/dnastructure Major GrooveMajor GrooveMinor GrooveMinor GrooveSignificance of DNA Structure•Maintenance of Code During Replication–A-T, C-G code retained during cell growth and division–Parent strands templates – code copied with fidelity•Provides Variety–Gene sequence of bases, genome collection of all DNA bases – responsible for uniquenessDNA Replication•Duplication of DNA molecule – passed to progeny•How does it begin?–Signal triggers cell machinery – duplication of chromosome, in which phase?–Must occur in 1 life cycle–E. coli – once every 20 mins.Enzymes of DNA Replication•Helicases - untwist and separate DNA strands•Topoisomerases - prevent breakage of DNA strands at fork due to torsion generated•Primase - RNA primer•DNA polymerase III – begins synthesis at primer•DNA polymerase I – chews up primer, replaces with DNA•DNA ligase – attaches fragments•Requires ~30 enzymesDNA Replication•Begins at Ori •Helicases – unwind DNA and break apart two strands•Topoisomerases – prevent breaking•Each strand will be used as a templatehttp://faculty.ircc.edu/FACULTY/TFischer/bio%201%20files/biohttp://faculty.ircc.edu/FACULTY/TFischer/bio%201%20files/bio%201%20resources.htm%201%20resources.htmDNA Replication•Begins at Ori with RNA primer – primase•DNA pol III adds bases - Elongation-Synthesis of 2 daughter strands using template by DNA pol III in 5’ -> 3’ direction•Semiconsevative process•EXAMPLE: Give complementary strand 5’ AACTGCATGGGCCATTTTAAG 3’ TTGACGTACCCGGTAAAATTChttp://faculty.ircc.edu/FACULTY/TFischer/biohttp://faculty.ircc.edu/FACULTY/TFischer/bio%201%20files/bio%201%20resources.htm%201%20files/bio%201%20resources.htmDNA Replication•Leading and Lagging strand formed at each fork•Leading continuously formed•Lagging uses primer every 100-1000 bases to synthesis new fragment.•Okazaki fragments•DNA Pol I removes primer and adds bases•DNA ligase joins fragments•Forks meet ligase joins strands - terminationhttp://lcvmwww.epfl.ch/~lcvm/dna_teaching_08_09/course_files/stasiak.hhttp://lcvmwww.epfl.ch/~lcvm/dna_teaching_08_09/course_files/stasiak.htmltmlCentral Dogma of Molecular Biology•Genome full of info, but DNA does not perform cell processes•Exceptions – RNA viruseswww.phschool.com/.../transcription/overview.htmlGene – Protein Connection•3 Categories of Genes1) Structural – protein2) genes code for RNA3) Regulatory – control gene expression- all three make up genotype (DNA)•Expressing of these make up phenotype•Review-Gene is DNA seq -> protein (a.a seq)-> 1 specific function (phenotype)RNA1) ss molecule, helix form, can form 2° and 3° structures due to H-bonds w/in molecule2) U instead of T3) Ribose instead of Deoxyribose4) All RNA formed through Transcription, only mRNA Translatedhttp://biology.kenyon.edu/courses/biol63/ribo/ribo.htmlTypes of RNA1) mRNA- messenger RNA-transcript (copy) of gene-message read as triplets called codon2) tRNA-transfer RNA-carries a.a. to ribosomes during translation-cloverleaf, 3 loops-bottom loop, anticodon 3) rRNA + protein = ribosome site of translationTranscription: DNA -> RNA•Eukaryotes occurs in nucleus – Where is DNA?•Initiation – RNA polymerase recognizes and binds promoter region on DNA.•Elongation – DNA unwinds, RNA Pol synthesizes RNA molecule in 5’->3’ direction.•Termination – RNA Pol recognizes another seq. and releases DNA and mRNA transcripthttp://faculty.ircc.edu/faculty/tfischer/micro%20resources.htmhttp://faculty.ircc.edu/faculty/tfischer/micro%20resources.htmReading the Message•mRNA encodes for a.a. sequence •Code is universal•Triplet = codon, 64 codons code for 20 a.a.5’ AUG GUU CCC UAA 3’Reading the Message•AUG is start codon•Example of mRNA: How many a.a.?5’ AAAUGUUUCAAAAAUAAGA 3’4 – Methionine, Phenalanine, Glutamine, Lysine, StopTranslation: mRNA -> Protein•Occurs at ribosomes in cytoplasm•Initiation: mRNA leaves DNA site, transported to ribosome 1) small subunit 30s binds mRNA, scans 5’->3’ for start codon 2) 1st charged tRNA carries fMet-Binds to mRNA via anticodon loop3) large subunit 50s binds complex, provide enzymes that form peptide bonds, fMet in P sitelibrary.thinkquest.org/.../rna/index.html library.thinkquest.org/.../rna/index.htmlTranslation: mRNA -> Protein•Elongation: 1) 2nd charged tRNA enters A site, peptide bond formed 2) Complex shifts, uncharged tRNA leaves, open A site3) next charged tRNA enters https://eapbiofield.wikispaces.com/17.2+and+17.4+Smithhttps://eapbiofield.wikispaces.com/17.2+and+17.4+SmithTranslation: mRNA -> Protein•Termination: Process repeated until stop codon, disassociation •Polyribosomes•Nearly 1200 ATP required for avg.