CMU BSC 03711 - Homework (5 pages)

Previewing pages 1, 2 of 5 page document View the full content.
View Full Document

Homework



Previewing pages 1, 2 of actual document.

View the full content.
View Full Document
View Full Document

Homework

94 views

Other


Pages:
5
School:
Carnegie Mellon University
Course:
Bsc 03711 - Computational Molecular Biology and Genomics
Computational Molecular Biology and Genomics Documents

Unformatted text preview:

03 511 711 Computational Genomics and Molecular Biology Fall 2003 1 Problem Set 0 This homework is intended to be a self administered placement quiz to help you and me determine if you have the background for the course or need to read additional material Collaboration is not allowed on this homework Due Thursday September 4th 1 To solve this problem you will need a table of the genetic code and the following table giving the physico chemical properties of the 20 amino acids small Gly Ala Ser Thr hydrophobic Val Phe Cys Tyr Ile Met Leu Trp Pro polar Asn Gln His basic Asp Glu acidic Lys Arg a Consider the fifth codon in the folloowing very short gene ATGGCAAGAAGCGCAACAACGGCGTGTAAGAGTTAA What amino acid does it encode and what physico chemical class does it belong to b How many possible base changes can occur in this codon c What is the probability that a single base change in this codon replaces the associated amino acid for one in the same class d What is the probability that a single base change in this codon leaves the amino acid unchanged 03 511 711 Computational Genomics and Molecular Biology Fall 2003 2 2 Short questions a What properties do viruses have in common with living organisms In what way are viruses different from living organisms b What is the relationship between the number of genes and the number of proteins in an organism Is your answer the same for bacteria and eukaryotes c Does recombination crossing over typically occur in bacteria Why or why not d State two basic differences between protein synthesis in prokaryotes and eukaryotes e What is the ribosome and what is its role in the cell f What is the difference between tRNA and mRNA 03 511 711 Computational Genomics and Molecular Biology Fall 2003 3 3 An X linked dominant allele causes hypophosphatemia low serum phosphorus in humans A man with hypophosphatemia marries a normal woman What proportion of their sons will have hypophosphatemia 4 An X linked recessive allele X c produces a red green



View Full Document

Access the best Study Guides, Lecture Notes and Practice Exams

Loading Unlocking...
Login

Join to view Homework and access 3M+ class-specific study document.

or
We will never post anything without your permission.
Don't have an account?
Sign Up

Join to view Homework and access 3M+ class-specific study document.

or

By creating an account you agree to our Privacy Policy and Terms Of Use

Already a member?