1CMSC 838T – Lecture 2CMSC 838T – Lecture 2X Premise of bioinformatics0 Gene sequences determine biological function0 Genomic DNA → RNA → ProteinsX This lecture0 Try to understand biological reasons for premise0 Review of molecular biology0 Describe useful experimental techniquesCMSC 838T – Lecture 2Molecular BiologyX Living organisms (on Earth) require ability to1. Separate inside from outside (lipids)2. Build 3D machinery to perform biological functions (proteins)3. Store information on how to build machinery (DNA)X Diagram of a cell0 Lipid membranes(provide barrier)0 Protein structures(do work)0 DNA nucleus(store info)2CMSC 838T – Lecture 2Molecular Biology: DNA, RNA, ProteinX DNA DNA → DNA (Replication)X RNA DNA → RNA (Transcription / Gene Expression)X Protein RNA → Protein (Translation)CMSC 838T – Lecture 2Deoxyribonucleic Acid (DNA)X Composition0 Sequence of nucleotides0 Nucleotide = deoxyribose sugar + phosphate group + baseBase3CMSC 838T – Lecture 2Nucleotide BasesX DNA0 A = Adenine0 T = Thymine0 C = Cytosine0 G = GuanineX RNA0 A = Adenine0 U = Uracil0 C = Cytosine0 G = GuanineAdenine ThymineCytosineGuanineUracilPurines PyrimidinesCMSC 838T – Lecture 2DNAX Physical structure0 Double (stranded) helix0 Sugar & phosphate groups form backbone0 Complementary bases (A-T, C-G) connected by hydrogen bond0 5’ = end w/ free phosphate group0 3’ = end w/ free oxygen group4CMSC 838T – Lecture 2Views of DNA StructureCMSC 838T – Lecture 2ACTGGCPPP3’PP3’5’5’5’ 3’3’ 5’P5CMSC 838T – Lecture 2DNA - Denaturation, HybridizationDenaturation Separating DNA into single strandsHybridization / AnnealingForming double-stranded DNAHeat CoolCMSC 838T – Lecture 2DNAX For bioinformatics0 DNA can be represented as a sequence of letters (A,C,G,T)0 5’ A T A C G T A 3’3’ T A T G C A T 5’ (matching strand, redundant)X Terms0 Base pair (bp) – one pair of DNA bases (1 letter)0 Gene – section of DNA that produces a functional product 0 Chromosome – physical linear sequence of DNA0 Genome – entire collection of DNA for an organismO E Coli 1 chromosome 5 x 106 bases (5 Mbps)O Drosophila 8 chromosomes 2 x 108 bases (200 Mbps)O Human 48 chromosomes 3 x 109 bases (3 Gbps)6CMSC 838T – Lecture 2DNA (Human Chromosomes)CMSC 838T – Lecture 2DNA ReplicationX DNA can be replicated1. DNA strands are split2. DNA polymerase (enzyme) reads one strand (template)3. Builds new (complementary) strand to form duplicate DNA7CMSC 838T – Lecture 2DNA ReplicationCMSC 838T – Lecture 2Ribonucleic acid (RNA)X Composition0 Sequence of nucleotides0 Nucleotide = ribose sugar + phosphate group + base0 Single stranded (but may form hairpin loops)0 Uracil (U) instead of Thymine (T)X DNA → RNA (Transcription / Gene Expression)0 RNA polymerase (enzyme) 1. Finds gene initiation marker (codon) on DNA strand2. Reads DNA strand containing marker3. Builds (complementary) strand of messenger RNA (mRNA)4. Stops when gene end marker (codon) found0 Resulting RNA sequence = transcript8CMSC 838T – Lecture 2Transcription Example (Step 1)CMSC 838T – Lecture 2Transcription Example (Step 2)9CMSC 838T – Lecture 2Transcription Example (Step 3)CMSC 838T – Lecture 2Transcription Example (Step 4)10CMSC 838T – Lecture 2Amino AcidX Proteins are composed of amino acidsX Composition0 Core + side chain (residue)0 20 different residues → 20 unique amino acidsA C D E F G H I K L M N P Q R S T V W Yside chain (residue)Amino acidCMSC 838T – Lecture 2Amino Acid PropertiesX Amino acids have different physical & chemical propertiesX Different amino acids are similar in different ways11CMSC 838T – Lecture 2RNA → Amino AcidX Codon = 3-base RNA sequence1. Code for amino acid2. Signal beginning / end of protein - open reading frame (ORF)CMSC 838T – Lecture 2List of Amino Acids (part 1)Amino acid Symbol CodonA Alanine Ala GC*C Cysteine Cys UGU, UGCD Aspartic Acid Asp GAU, GACE Glutamic Acid Glu GAA, GAGF Phenylalanine Phe UUU, UUCG Glycine Gly GG*H Histidine His CAU, CACI Isoleucine Ile AUU, AUC, AUAK Lysine Lys AAA, AAGL Leucine Leu UUA, UUG, CU*12CMSC 838T – Lecture 2List of Amino Acids (part 2)Amino acid Symbol CodonM Methionine Met AUGN Asparagine Asn AAU, AACP Proline Pro CC*Q Glutamine Gln CAA, CAGR Arginine Arg CG*, AGA, AGGS Serine Ser UC*, AGU, AGCT Threonine Thr AC*V Valine Val GU*W Tryptophan Trp UGGY Tyrosine Tyr UAU, UACCMSC 838T – Lecture 2Transcription & Open Reading FramesX Open Reading Frame (ORF)0 Where to start reading codons (ATG)0 6 possible reading frames (3 forward, 3 backward)0 Gene is usually longest ORF found X Forward reading frame example5' atgcccaagctgaatagcgtagaggggttttcatcatttgaggacgatgtataa 3'1 atg ccc aag ctg aat agc gta gag ggg ttt tca tca ttt gag gac gat gta taa M P K L N S V E G F S S F E D D V *2 tgc cca agc tga ata gcg tag agg ggt ttt cat cat ttg agg acg atg tat C P S * I A * R G F H H L R T M Y 3 gcc caa gct gaa tag cgt aga ggg gtt ttc atc att tga gga cga tgt ata A Q A E * R R G V F I I * G R C I13CMSC 838T – Lecture 2ProteinX Composition0 ~40-500+ amino acids connected in polypeptide chain0 Sequence determines 3D shape (and function) of proteinamino endcarboxyl endside chains (residue)H2OAmino acidAmino acidformspeptide bondCMSC 838T – Lecture 2Protein StructureCαR2NHCOCαR1+H3NCONHCαR3COO-ΦψXPrimary structure (1D sequence)0 Order of amino acid (residues)0 Always begin at amino end (by convention)0 Example (Hexokinase): A A S X D X S L V E V H X X V F I V …amino endresiduespeptide bondscarboxyl end14CMSC 838T – Lecture 2Protein StructureX Secondary structure (primary substructure)X Alpha helixX Beta strand / pleated sheetX CoilAlpha helix Beta strandCMSC 838T – Lecture 2Protein StructureX Tertiary structure (overall 3D structure)X Quaternary structure (only for multi-chain structures)HemoglobinHexokinase15CMSC 838T – Lecture 2Protein SynthesisX RNA → Protein (Translation)1. Messenger RNA (mRNA) brings information from nucleus to ribosome2. Transfer RNA (tRNA) brings amino acids to ribosome3. Ribosomematches tRNA to mRNA to produce proteinCMSC 838T – Lecture 2Transfer RNA (tRNA)X Anticodon in tRNA matches codon in mRNA16CMSC 838T – Lecture 2Protein Synthesis Example (Step 1)CMSC 838T – Lecture 2Protein Synthesis Example (Step 2)17CMSC 838T – Lecture 2Protein Synthesis Example