11STARTSTARTFOUNDATIONSFOUNDATIONSHow-to 1How-to 1FORMATIONFORMATIONHow-to 2How-to 2SYSTEMSSYSTEMSPROBLEMSPROBLEMSFuture ofFuture ofBIOCHEM GENETICS CELL BIO.MOL. BIOSTEM CELLS,CLONINGREC. DNACELL TYPE3DSTRUCTUREFERTILI-ZATIONSYSTEMSVIRUSESIMMUNELIFELIFENERVOUSCANCER2Student question of the dayQ: In the last lecture, what allele was convertedfrom mRNA into cDNA?A: Typically all of the alleles of all expressedgenes are converted into cDNA in the sametube. We can clone the resulting cDNAs tosort through them – the result is a cDNAlibrary.23http://de.wikipedia.org/wiki/5-Brom-4-chlor-3-indoxyl-%CE%B2-D-galactopyranosidA white colony reports the presence of an insert in thelacZ gene causing X-GAL to not be cleavedX-GAL + lacZ -> blue colonyPlate on growth media + ampicillin + X-GAL4Fireflies making luciferase, from Life by Purves et al, 7th edition35http://www.pgec.usda.gov/Ow/A10-1986OwetalScience.pdfLuciferase (in cells) + Luciferin (in media) -> Luminescence 6http://en.wikipedia.org/wiki/Green_fluorescent_proteinHit the Beach! In 8 colors…47ddA ddG ddC ddT5’ GAGTAACCGGTATGCA3’Separate DNA fragments of different length3’ACGTATGGCCAATGAG5’1.denature 2. gelelectro-phoresis-+longest, slowest migratingshortest, fastest migratingsequence8A control and a transgenic mouse expressing rat growth hormone, from Introduction to Genetic Analysis by Griffiths et al, 8th edition59http://clinicaldepartments.musc.edu/transgenicmouseX-gal staining in the head region of a transgenicmouse embryo (day 16 of gestation) carrying aHoxc13-lacZ reporter gene.10611A chimeric mousehttp://intramural.nimh.nih.gov/tgc/photogallery.html12GFP mice and blastocysts, from Molecular Cell Biology by Lodish et al, 5th edition713Nuturing defect in FosB mutant mice, from http://www.cell.com/content/issue?volume=86&issue=2Fos family proteins trigger neuronal responses in the brain and are expressed in response to environmentalstimuli14Terms• Host• Virus• Reporter• Tissue specific promoter• DNA sequencing• Sanger method• Resequencing• dideoxyribonucleosidetriphosphate (ddNTP)• SNP• Haplotype• Oligonucleotide• Gene therapy• Host immune response• Oncogene• Transgenic• Transgene815DNA sequencing1. What is this? Determine the base sequence of DNA fragment2. Why?Coding capacity of a geneGene identificationDisease gene/ allele identificationEvolutionary relationshipsGenome analysis- promoters, centromeres..16Dideoxy nucleotides terminate DNA polymerization+dNTPsDNA polymerasepolymerizationterminateswhere a ddNTP is incorporatedpolymerization ofwhole fragment3’ 5’5’ 3’templateprimer+dNTPs+ low level ddNTPs DNA polymerase3’ 5’5’ 3’templateprimer917Dideoxy DNA sequencing/ ddATP as example3’ACTGGTACTCATTGGCCATACGTG5’5’TGACCAT3’3’ACTGGTACTCATTGGCCATACGTG5’5’TGACCATGAGTAA3’ACTGGTACTCATTGGCCATACGTG5’5’TGACCATGAGTAACCGGTA3’ACTGGTACTCATTGGCCATACGTG5’5’TGACCATGAGTAACCGGTATGCAA= ddATP (low)+dNTP (high)DNA polymeraseradioactive orfluorescent labelpolymerizedfragmentsterminate whereddA incorporatesLength of terminated fragment indicates position of ANeed to do separate reactions containing +ddATP, +ddCTP, +ddGTP, +ddTTP18Making a knockout mouse, from Life by Purves et al, 7th edition1019Making knock-out mice(see Fig. 16.9)3.5 dayembryoES cells(Embryonic Stem)ES cells in culturegene targeting selection “Targeted” Aa ES cells3.5 dayembryo/blastocystAAcellsimplantchimericmouseAacellsembryos developprogeny bornAAcellsAabreed to wild typemouseAaXaa ?A Wild type allelea Knock
View Full Document