A Brief HistoryDarwinEarly HistoryModern PhylogeneticsUses of PhylogeniesTreesPhylogenetic TreesBret LargetDepartments of Botany and of StatisticsUniversity of Wisconsin—MadisonSeptember 8, 2009Genetics/Botany 629 (Fall 2009) Phylogenetic Trees September 8, 2009 1 / 13A Brief History DarwinPhylogenetics and DarwinIn 1837, shortly after his famous five-year voyage as naturalist on theBeagle, Darwin sketched a tree diagram in one of his notebooks.This simple sketch is remarkably similar to modern diagrams ofphylogenies.In addition, the sole figure in The Origin of Species (1859) is aphylogeny.Genetics/Botany 629 (Fall 2009) Phylogenetic Trees September 8, 2009 2 / 13A Brief History DarwinDarwin’s TreesGenetics/Botany 629 (Fall 2009) Phylogenetic Trees September 8, 2009 3 / 13A Brief History Early HistoryEarly HistoryShortly after the 1859 publication of The Origin of Species, manybiologists came to accept the truth of a universal Tree of Life.Ernst Haeckel and many others created highly stylized trees that werebased on expert opinion.A century passed before development of formal scientific methods forestimating phylogenies began.Genetics/Botany 629 (Fall 2009) Phylogenetic Trees September 8, 2009 4 / 13A Brief History Early HistoryHaeckel’s TreesGenetics/Botany 629 (Fall 2009) Phylogenetic Trees September 8, 2009 5 / 13A Brief History Modern PhylogeneticsWhat is the Origin of Whales?dolphin ATGACCAACATCCGAAAAACACACCCTCTAATAAAAATCCTCgiant sperm whale ATGACCAACATCCGAAAATCACACCCATTAATAAAAATCATTbowhead whale ATGACCAACATCCGAAAAACACACCCACTAATAAAAATTATTright whale ATGACCAACATCCGAAAAACACACCCAGTAATAAAAATTATTminke whale ATGACCAACATCCGAAAAACACACCCACTAATAAAAATTATCfin whale ATGACCAACATCCGAAAAACACACCCACTAATAAAAATCGTCblue whale ATGACCAACATCCGAAAAACACACCCACTAATAAAAATCATChumpback whale ATGACCAACATCCGAAAAACACACCCACTAATAAAAATTATC...hippopotamus ATGACAAACATCCGAAAATCTCACCCCTTAATAAAAATTATCcamel ATGACAAACATCCGAAAATCACACCCACTTCTAAAAATTATApig ATGACCAACATCCGAAAATCACACCCACTAATAAAAATTATCcow ATGACTAACATTCGAAAGTCCCACCCACTAATAAAAATTGTAsheep ATGATCAACATCCGAAAAACCCACCCACTAATAAAAATTGTAgoat ATGACCAACATCCGAAAGACCCACCCATTAATAAAAATTGTAGenetics/Botany 629 (Fall 2009) Phylogenetic Trees September 8, 2009 6 / 13A Brief History Modern PhylogeneticsAn Estimated Whale Phylogeny09/04/2007 09:10 AMScienceDirect - Full Size ImagePage 1 of 2http://www.sciencedirect.com/science?_ob=MiamiCaptionURL&_method…urlVersion=0&_userid=443835&md5=df655f7ee732c807488f9262b841bcfcCLOSEGenetics/Botany 629 (Fall 2009) Phylogenetic Trees September 8, 2009 7 / 13A Brief History Uses of PhylogeniesWhy is Phylogenetics Important?It is an exaggeration to say phylogenetics are everywhere, butphylogenetic trees are used in many areas of biology beyond theobvious area of systematics.Other areas include forensics and developmental biology.From a statistical point of view, the evolutionary history of organismsmeans that species should not be treated as independent samples.Even if evolutionary relationships are not of primary interest, a goodstatistical analysis might need to account for the phylogeny to explainsome part of the dependence among observations from differentspecies.Genetics/Botany 629 (Fall 2009) Phylogenetic Trees September 8, 2009 8 / 13A Brief History Uses of PhylogeniesWhy is Phylogenetics Important?It is an exaggeration to say phylogenetics are everywhere, butphylogenetic trees are used in many areas of biology beyond theobvious area of systematics.Other areas include forensics and developmental biology.From a statistical point of view, the evolutionary history of organismsmeans that species should not be treated as independent samples.Even if evolutionary relationships are not of primary interest, a goodstatistical analysis might need to account for the phylogeny to explainsome part of the dependence among observations from differentspecies.Genetics/Botany 629 (Fall 2009) Phylogenetic Trees September 8, 2009 8 / 13A Brief History Uses of PhylogeniesWhy is Phylogenetics Important?It is an exaggeration to say phylogenetics are everywhere, butphylogenetic trees are used in many areas of biology beyond theobvious area of systematics.Other areas include forensics and developmental biology.From a statistical point of view, the evolutionary history of organismsmeans that species should not be treated as independent samples.Even if evolutionary relationships are not of primary interest, a goodstatistical analysis might need to account for the phylogeny to explainsome part of the dependence among observations from differentspecies.Genetics/Botany 629 (Fall 2009) Phylogenetic Trees September 8, 2009 8 / 13A Brief History Uses of PhylogeniesWhy is Phylogenetics Important?It is an exaggeration to say phylogenetics are everywhere, butphylogenetic trees are used in many areas of biology beyond theobvious area of systematics.Other areas include forensics and developmental biology.From a statistical point of view, the evolutionary history of organismsmeans that species should not be treated as independent samples.Even if evolutionary relationships are not of primary interest, a goodstatistical analysis might need to account for the phylogeny to explainsome part of the dependence among observations from differentspecies.Genetics/Botany 629 (Fall 2009) Phylogenetic Trees September 8, 2009 8 / 13A Brief History Uses of PhylogeniesForensic Phylogenetic Tree30 HIV Forensics Reviews12Figure 210%A40A34 A41 A32A37A36A30A39A38A44B28B29 B22B25B27B26B24B23A43A31 A33 A42MBC925SFMHS2JH32US2 SCLC50LC49OYI SF2 ENVVA GB8.C1ENVVF SF128APHI159SFMHS1ADA YU2 HAN SFMHS7US3 ALA1MANCWEAU160 JRCSF WR2789SP061 ENVVG D31 MBC18 MBCD36US1 SFMHS8HXB2RL42TH936705CDC452LC47 LC46 MBC200SFMHS20 ENVUSR2 PHI13385WCIPR54 CAM1NY5CG MNCGP896SC14C US4 DH123 BRVALC45 LC48 43RF10078100100100Figure 2. Neighbor-joining phylogram representing the reconstruction of the phylogenetic relationshipsbetween the env (C2-V5) sequences obtained from the index case (A31-44), the alleged recipient (B22-29), three local controls (LC45 and LC48; LC46 and LC47; and LC49 and LC50) and 48 sequenceschosen from GenBank. Ten iterations of random sequence addition were used. Scale bar represents10% genetic distance. Bootstrap values are shown at nodes with greater than 70% support.Genetics/Botany 629 (Fall 2009) Phylogenetic Trees September 8, 2009 9 / 13TreesActivity 1: Example TreeABCDEFGenetics/Botany 629 (Fall 2009) Phylogenetic Trees September 8, 2009 10 / 13TreesActivity 2: Compare