Introduction to Computational Biology CS374 Autumn 2006 Lecture 1 9/26/06 Lecturer: Serafim Batzoglou Scribe: Ravi Tiruvury LECTURE I - INTRODUCTION TO COMPUTATIONAL BIOLOGY PRESENTER – PROF. SERAFIM BATZOGLOU SCRIBE – RAVI TIRUVURY Table Of Contents 1 Introduction to Computational Biology 2 Introducing… the Cell 3 Deoxyribose Nucleic Acid (DNA) 3.1 Introduction & Discovery 3.2 Structure 3.3 DNA – Transcription, Translation and Folding 3.4 DNA and its importance 3.5 DNA & Gene Trivia 4 Proteins 5 Current Trends in Computational Biology 5.1 DNA Sequencing 5.2 DNA Microarrays 5.3 Data on Human Variation – Phylogenetic Trees 6 Examples of applying CS to Biology 6.1 Genome Sequencing 6.2 Gene Finding 6.3 Protein Folding 6.4 Sequence Analysis and Comparison 6.5 Sequence Alignment 6.6 Protein Networks 6.7 Genetic Evolution 6.8 Building Circuits from Cells 7 Computer Scientists vs Biologists 8 Appendix – About the Cell 9 Glossary of Important TermsIntroduction to Computational Biology CS374 Autumn 2006 Lecture 1 9/26/06 Lecturer: Serafim Batzoglou Scribe: Ravi Tiruvury 1. INTRODUCTION TO COMPUTATIONAL BIOLOGY Computational Biology is an interdisciplinary field that applies CS techniques to biological problems. It has been around only since the last 5 – 10 years, and is projected to have a bright future in the academia and research. The field itself is a conglomerate of other fields including Genetics, Developmental Biology, Computer Science, Mathematics and Statistics. The major fields that use computational biology techniques include Bioinformatics and Genomics. Computational Biology primarily aims at providing methods and techniques to organize and analyze massive amounts of biological data. It helps in: • Enabling biologists to work with and use large chunks of data • Helps biologists formulate testable hypotheses • Aids in discovering and exploring new biology 2. INTRODUCING… THE CELL, DNA AND PROTEINS The cell is the structural and functional unit of all living organisms – it is the "building block of life." An average human has up to 100 trillions of cells. The Cell with DNA in the Nucleus and Proteins in the Cytoplasm As shown in the picture above, within the cell exist several intracellular parts called Organelles, which have been described in the Appendix. The nucleus of the cell contains the genetic information which describes the entire characteristics of an organism. This genetic information is contained in the form of ribbon-like structures called DNA, or Deoxyribonucleic Acid. 3. DEOXYRIBONUCLEIC ACID (DNA) 3.1 Introduction & Discovery: The 3D double-helical structure of DNA was first proposed, about 50 years ago, by Physicist-Ornithologist duo - Watson and Crick. This signaled the beginning of molecular biology. Deoxyribonucleic acid (DNA) is a nucleic acid that contains the genetic instructions for the biological development of a cellular form of life or a virus.Introduction to Computational Biology CS374 Autumn 2006 Lecture 1 9/26/06 Lecturer: Serafim Batzoglou Scribe: Ravi Tiruvury Chemically, DNA is a long polymer of nucleotides (a polynucleotide) that encodes the sequence of amino acids. A nucleotide is a unit of DNA that consists of one chemical nitrogenous base, a phosphate group and a sugar molecule, as shown in the picture below: 3.2 Structure: DNA is a ribbon-like double helical structure that comprises strands of molecules held together by hydrogen bonds. Each strand is approximately 3 x 109 long, and comprises the following bases: Adenine (A), Cytosine (C), Guanine (G) and Thymine (T). These can be arranged in different ways. DNA contains the genetic information that is inherited by the offspring of an organism. This information is determined by the sequence of base pairs along its length. A strand of DNA contains: • genes, • areas that regulate genes, and • areas that either have no function, or a function yet unknown. Each base on one strand forms a bond with just one kind of base on another strand, called a "complementary" base: A bonds with T, and C bonds with G. Two nucleotides paired together are called a base pair. Why is the DNA double-stranded? To aid replication. TCACTGGCGAGTCAGCTCACTGGCGAGTCAGC Phosphate GroupSugarNitrogenousBasePhosphate GroupSugarNitrogenousBaseIntroduction to Computational Biology CS374 Autumn 2006 Lecture 1 9/26/06 Lecturer: Serafim Batzoglou Scribe: Ravi Tiruvury 3.4 DNA and its Importance DNA is primarily involved in Protein Synthesis, which has been listed below. Apart from this, DNA is also responsible for the genetic propagation of most inherited traits, including features and diseases. The genetic information encoded by an organism's DNA is called its genome. DNA is transmitted from parent to offspring, and this causes children to have resembling features from both their parents. To be specific, the mitochondrial DNA comes from the mother, and the Y chromosome from the father. 3.5 DNA & Gene Trivia • Genetically, two humans are similar upto 99.95% • DNA is an acid because of the phosphate groups between each deoxyribose. • Mutation: It is a result of the cells' attempts to repair chemical imperfections (such as a base that is accidentally skipped, inserted, or incorrectly copied, or the chain is trimmed, or added to). Many mutations can be described as combinations of these accidental "operations". • Evolution: Random changes in DNA over evolution brings different species – but its very difficult to predict what the possible changes can be. 4. PROTEINS: Fig. 3D Protein Structure Fig. Protein and Peptide Bonds (Courtesy: http://www.chem.bham.ac.uk/labs/snaith/images/B27-2.gif) Proteins are large organic compounds made of amino acids arranged in a linear chain and joined by peptide bonds. They are arranged/sequenced using an “alphabet” of 20 amino acids. The
View Full Document
Unlocking...