MIT OpenCourseWare http://ocw.mit.edu 5.36 Biochemistry Laboratory Spring 2009 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.________________________________________________________________________________ ________________________________________________________________________________ 5.36 Lecture Summary #2 Tuesday, February 10, 2009 Next Laboratory Session: #3 Topics: Molecular Cloning and Site-Directed Mutagenesis I. Overview of Molecular Cloning II. Ligation (Step 1 of Cloning)A. Polymerase chain reaction (PCR) B. Restriction enzymes and gene insertion C. Session 3: digestion to check for the Abl(229-511) insert III. DNA Site-Directed Mutagenesis A. PCR primer design B. Overview of the Quickchange strategy (preview of sessions 9-11) I. OVERVIEW OF MOLECULAR CLONING REVIEW OF DNA The central dogma of biology: DNA → RNA → protein (→ protein folding and post-translational modification) We are interested in expressing and studying proteins, so we need to start with thecorrect DNA or alter the DNA to make desired protein mutants. Adenine (a) _____________ ( ___ ) _______________________ backbone CCN CHNCNHCNNC NCHCCOONHCH3HHCCN CNCNHCNN HHHNC NCHCHCNHHOOOOOOPPPOOOATGOOOOHPPHOO POOOGuanine (g) _____________ ( ___ ) The 5’ end of a DNA strand terminates with a ______________ group. The 3’ end of aDNA strand terminates with a _______________ group. By convention, we write a DNA sequence ____’ to ____’.A DNA single strand is defined as a _____________ strand if the mRNA version of the identical sequence can be translated to a protein. The compliment DNA sequence (the opposite strand) is called the _______________ strand. Hydrogen bonding binds together complementary strands of DNA to form adouble helix. The lower bond enthalpies of hydrogen bonds compared to covalent bonds facilitate the separation of DNA strands during DNA replication. DNA CLONING: IN-VIVO AMPLIFICATION OF DNA 1. ____________________ 2. ____________________ 3. ____________________ In Modules 4 and 5, we are using E. coli cells for storage and expression. _________ for storage. _____________ for protein expression. For lab Session 2, you were provided with: • BL21(DE3) cells transformed with an H396P Abl(229-511)-encoding vector for protein expression. • DH5α cells transformed with a wt Abl(229-511)-encoding vector for isolation of the wt vector DNA (by doing a miniprep).II. LIGATION (step 1 in molecular cloning) A) POLYMERASE CHAIN REACTION (PCR) How do we get enough of the desired DNA insert to work with for the ligation? How can we introduce RE cut sites into the insert DNA? Answer: PCR • Allows you to amplify desired regions of DNA • Utilizes in vitro enzymatic replication by a polymerase (such as Taq or Pfu) polymerase: an enzyme that catalyzes the polymerization of deoxyribonuclotides(dATP, dGTP, dTTP, and dCTP) into a strand of DNA. 5'5'3'3'1) Denaturation5'3'5'3'2) Annealing5'3'5'3'5'3'5' 3'3) Elongation5'3'5'3'5'3'5'3'1)Denaturation2) Annealing3) Elongation5'3'5'3'5'3'5'3'5' 3'5'3'1)Denaturation2) Annealing3) Elongation5'3'5'3'5'3'5'3'3'5'3'5'3'5'3'5'3'5'3'5'3'5'3'5'3'5'3'5'3'5'3'5'3'5'Exponential growth of the PCR product with continuing cyclesGeneral components of any PCR reaction: • Template DNA. DNA that includes the desired sequence to be amplified. • Nucleotides (________s). The buildingblocks to build new DNA strands. • Primers. Complimentary _________ tothe start and end of target sequence. • A _________________ polymerase(such as Taq or Pfu) • A buffer compatible with thepolymerase • Thermal cycler General PCR protocol for thermal cycling: • Initialization Step (92 oC for 2 min): Activates the heat-stable polymerase • 25-30 cycles of1) Denaturation Step (___ oC): denatures template DNA2) Annealing Step (___ oC): allows________ to anneal to target sequences3) Elongation Step (72 oC): elongationof the annealed primers • Final Elongation Step (72oC for 10 min) For a video of pcr in action, see http://www.dnalc.org/ddnalc/resources/animations.html. PCR yields enough of the target DNA insert for subsequent ligation.__________ __________ ’B) RESTRICTION ENZYMES AND GENE INSERTION Question: How do you get the desired DNA insert into the vector? Restriction Enzymes (also called ___________________) selectively cut DNA within a specific sequence (called a ______________ site) by cleaving a ___________________ bond within the DNA backbone. For restriction enzymes that cleave double-stranded DNA, some cut straight across the DNA molecule producing _________ ends. Others cut in an offset fashion producing _________ ends. Examples of restriction enzymes and their corresponding recognition sites: “blunt end” REs “sticky end” RE’s Sma1 Alu1 Sca1 5'...CCCGGG...3'3'...GGGCCC...5'5'...AGCT...3'3'...TCGA...5'5'...AGTACT...3'3'...TCATGA...5'5'...GATATC...3'3'...CTATAG...5'EcoR1 EcoRV BamH1 Sac1 5'...CATATG...3'3'...GTATAC...5'5'...CTCGAG...3'3'...GAGCTC...5'5'...GAATTC...3'3'...CTTAAG...5'5'...GGATCC...3'3'...CCTAGG...5'5'...GAGCTC...3'3'...CTCGAG...5'Circle the RE sites above that are found in the cloning region of the pET-28a vector: 5 CCATATGGCTAG…GGATCCGAATTCGAGCTCCGTCGACAAGCTGCGGCCGC ACTCGAG 3’ Resources for visualizing/identifying RE cut sites • The information sheet that comes with commercial vectors. (The pET-28a vector information sheet will be available in the lab for session #3.) • Vector visualization software: Ape (free) http://www.biology.utah.edu/jorgensen/wayned/ape/ Vector NTI (free if you provide an academic e-mail address)https://catalog.invitrogen.com/index.cfm?fuseaction=userGroup.homeSo how was the wt Abl(229-511)-containing vector DNA (isolated in Session 2) constructed? Cut both desired DNA fragment and vector with the same restriction enzymes (a digestion) then incubate together. Use a DNA Ligase to connect 5’ and 3’ sticky ends and create a continuous plasmid. C) LAB SESSION 3: DIGESTION TO CHECK FOR THE ABL(229-511) INSERT It is common to receive cloning/expression vectors containing a DNA insert of interest from another laboratory…and it is wise to check that these vectors contain the DNA you are expecting. You can check your vector by: • DNA ______________ (This is the most thorough method.) • Restriction digestion (to confirm the DNA insert size and location) Session 3 will entail restriction digestion of the wt