View Full Document

2 views

Unformatted text preview:

statistical systems biology department of applied physics and applied mathematics center for computational biology and bioinformatics columbia university chris wiggins columbia edu statistical systems biology agenda 1 challenges to keep in mind 2 microarrays regulation 3 networks 4 final thoughts statistical systems biology challenges 1 statistics 2 modeling 3 validation 4 interpretation microarrays transcriptional regulation 1 biological questions 2 history context 3 methods unsupervised cluster first ask questions later supervised predicting methods biology as told by a theorist biology as told by a biologist ptashne s a genetic switch what is to be measured 1 expression via RNA abundance what is to be measured 2 regulatory sequence YLR081W GAL2 CEN AGGTTGCAATTTCTTTTTCTATTAGTAGCTAAAAATGGGTCACGTGATCT GAL4 ATATTCGAAAGGGGCGGTTGCCTCAGGAAGGCACCGGCGGTCTTTCGTCC GTGCGGAGATATCTGCGCCGTTCAGGGGTCCATGTGCCTTGGACGATATT GAL4 AAGGCAGAAGGCAGTATCGGGGCGGATCACTCCGAACCGAGATTAGTTAA GCCCTTCCCATCTCAAGATGGGGAGCAAATGGCATTATACTCCTGCTAGA AAGTTAACTGTGCACATATTCTTAAATTATACAACATTCTGGAGAGCTAT TGTTCAAAAAACAAACATTTCGCAGGCTAAAATGTGGAGATAGGATAAGT TTTGTAGACATATATAAACAATCAGTAATTGGATTGAAAATTTGGTGTTG TGAATTGCTCTTCATTATGCACCTTATTCAATTATCATCAAGAATAGTAA TAGTTAAGTAAACACAAGATTAACATAATAAAAAAAATAATTCTTTCATA ATGGCAGTTGAGGAGAACAATATGCCTGTTGTTTCACAGCAACCCCAAGC 451 401 351 301 251 201 151 101 51 1 50 GeneChip R late 80 s cDNA spot arrays 1995 the hope other relevant innovation shared data microarrays transcriptional regulation 1 biological questions 2 history context 3 methods unsupervised cluster first ask questions later supervised predicting methods descriptive models of regulation Spellman et al Molecular Biology of the Cell 1998 Dec 9 12 3273 97 unsupervised no input output relation descriptive models of regulation unsupervised no input output relation microarrays transcriptional regulation 1 biological questions 2 history context 3 methods unsupervised cluster first ask questions later supervised predicting



Access the best Study Guides, Lecture Notes and Practice Exams

Loading Unlocking...
Login

Join to view statistical systems biology and access 3M+ class-specific study document.

or
We will never post anything without your permission.
Don't have an account?
Sign Up

Join to view statistical systems biology and access 3M+ class-specific study document.

or

By creating an account you agree to our Privacy Policy and Terms Of Use

Already a member?