Molecular Genetics Exam I page 1 of 5 BSCI410 Tuesday, October 10, 2006 Your name: _____________________________________________________________ ------------------------------------------------------------------------------------------------------------- Define the following terms (5 points each): OMIM twin spot RefSeq codominant alleles templateMolecular Genetics Exam I page 2 of 5 BSCI410 Tuesday, October 10, 2006 Your name: _____________________________________________________________ ------------------------------------------------------------------------------------------------------------- Questions 1-4 are worth 5 points each. They concern two recessive mouse mutations, clubpaw1 (cp1) and clubpaw2 (cp2), that show the identical phenotype (fused digits on the paw). You first want to test whether these mutations are in the same gene. You cross cp1 homozygotes with cp2 homozygotes. For each of the four cases below, predict the frequency of mice with fused digits (assuming simple Mendelian ratios). 1) If cp1 and cp2 complement, you expect ______ % of the F1 mice to have fused digits. 2) If cp1 and cp2 do not complement, you expect ______ % of the F1 mice to have fused digits. 3) If cp1 and cp2 complement, you expect ______ % of the F2 mice to have fused digits. 4) If cp1 and cp2 do not complement, you expect ______ % of the F2 mice to have fused digits. 5. (5 points) Three wild-type alleles, 1, 2 and 3, are present in a population in Hardy-Weinberg equilibrium and no other alleles are present at appreciable frequencies. Homozygotes for allele 1 represent 16% of the population, and homozygotes for allele 2 represent 9% of the population. What fraction of the population is homozygous for allele 3? 6. (5 points) Allele 3 confers a semidominant increased risk of early-onset Alzheimer's disease. What fraction of the population shows the intermediate level of risk associted with heterozygosity for alelle 3?Molecular Genetics Exam I page 3 of 5 BSCI410 Tuesday, October 10, 2006 Your name: _____________________________________________________________ ------------------------------------------------------------------------------------------------------------- 7. (5 points) Here is the sequence of the template strand of a DNA fragment: GTCGCCGTGCAATGATGTAGGCGACTATGGTTGA Applying the standard convention for polarity (which end is 5' and which is 3'), which of the following would be the complementary, nontemplate, strand? a) TCAACCATAGTCGCCTACATCATTGCACGGCGAC b) AGTTGGTATCAGCGGATCTAGTAACGTGCCGCTG c) GTCGCCGTGCAATGATGTAGGCGACTATGGTTGA d) CAGCGGCACGTTACTACATCCGCTGATACCAACT Problems 8-10 (4 points each). In each of the following there are two or more statements. One is true (generally, it is taken directly from your textbook) and the others have been modified so that to be untrue or misleading. Circle, check or otherwise designate the correct statement. Ambiguous marks (checking both, placing a mark between the two statements, etc.) will be considered wrong. 8. a The primer DNA provides a terminus with a free 5'-OH to which nucleotides are added during DNA synthesis. b The template DNA provides a terminus with a free 5'-OH to which nucleotides are added during DNA synthesis. c The primer DNA provides a terminus with a free 3'-OH to which nucleotides are added during DNA synthesis. 9. a A particular mutant allele is either dominant or recessive for all traits that it affects. b The same mutant allele can be dominant with respect to some traits and recessive with respect to others. 10. a The probability of two independent events occurring together is the product of the probabilites that each event will occur by itself. b The probability of two independent events occurring together is the sum of the probabilites that each event will occur by itself.Molecular Genetics Exam I page 4 of 5 BSCI410 Tuesday, October 10, 2006 Your name: _____________________________________________________________ ------------------------------------------------------------------------------------------------------------- Consider two genes: ABC1 and DEF2. When a wild-type (ABC1 and DEF2) strain is crossed to a doubly mutant strain (abc1 and def2) and sporulated, the following tetrads are observed: 83 tetrads with two ABC1 DEF2 spores and two abc1 def2 spores. 79 tetrads with two ABC1 def2 spores and two abc1 DEF2 spores. no tetrads of any other type. 11. (5 points) Are these two genes linked to each other (yes or no)? 12. (5 points) Are these genes linked to the centromere (i.e. is ABC1 centromere-linked? Is DEF2 centromere-linked?) Either or both can be true. Select one of the following: a Neither is centromere-linked and they are not linked to each other. b Both are centromere-linked, and they are on the same chromosomes (linked to each other). c Both are centromere-linked, but they are on different chromosomes (not linked to each other). d One is centromere-linked, which makes it impossible to determine whether the other (which is not linked to the first) is also centromere-linked. e The two genes are linked to each other, and this makes it impossible to determine whether they are centromere-linked. 13. (10 points) Which of the following are true? None, all or any number can be true. (circle the letter corresponding to each that is true; this is really 5 true/false questions)? a Experimental recombination frequencies between two genes are never greater than 50% b The two terms centimorgan and map unit are interchangeable. c When two genes are linked parental ditypes will outnumber nonparental ditypes. d When two genes are unlinked the number of parental ditypes will be approximately the same as the number of nonparental ditypes. e When two genes are linked but 60 cM. or farther apart the number of parental ditypes will be approximately the same as the number of nonparental ditypes.Molecular Genetics Exam I page 5 of 5 BSCI410 Tuesday, October 10, 2006 Your name: _____________________________________________________________ ------------------------------------------------------------------------------------------------------------- 14. (3 points) Consider the following two possible aligments. yfg (your favorite gene) differs from each of the other two sequences by three substitutions in the region of alignment shown. To which sequence (1