BSCI 410 Molecular Genetics Homework 1 and Review for the first exam. This homework 1 is due Tuesday, Sep. 23; the exam will be Thursday, Oct. 2, 2008 Coverage: Lectures 1-6 pg. 1 ------------------------------------------------------------------------------------------------------------- ------------------ 1 Homework Questions due Sept. 23, 2008. The exam will cover material from lectures 1-6. Homework is 20 points altogether. Review questions begin after the homework (pg. 3). Please put your answers on another piece of paper. If you use more than one piece of paper please use a stapler. 1. (1 point) Here is the sequence of the template strand of a DNA fragment: 5' CAAGTTGTAACTCTAGGTTAGTCGCTACCTGTAGTCATTTA 3' Which of the following would be the complementary, nontemplate, strand? a) 5' TAAATGACTACAGGTAGCGACTAACCTAGAGTTACAACTTG 3' b) 5' ATTTACTGATGTCCATCGCTGATTGGATCTCAATGTTGAAC 3' c) 5' CAAGTTGTAACTCTAGGTTAGTCGCTACCTGTAGTCATTTA 3' d) 5' GTTCAACATTGAGATCCAATCAGCGATGGACATCAGTAAAT 3' 2. Consider two genes: ABC1 and DEF1. When a wild-type (ABC1 and DEF1) strain is crossed to a doubly mutant strain (abc1 and def1), the following tetrads are observed: 170 tetrads with two ABC1 DEF1 spores and two abc1 def1 spores. 2 tetrads with two ABC1 def1 spores and two abc1 DEF1 spores. 28 tetrads with: one ABC1 DEF1 spore, one abc1 def1 spore, one ABC1 def1 spore and one abc1 DEF1 spores a) (1 point) What is the observed recombination fraction? b) (1 point) What is your best estimate of the distance between ABC1 and DEF1 in cM.? Explain 3. (2 points) Consider two genes: GHI1 and GHI2. GHI1 is almost precisely at the centromere of a chromosome while GHI2 is 60 cM. away from the centromere on one arm of the same chromosome. When a wild-type (GHI1 and GHI2) strain is crossed to a doubly mutant strain (ghi1 and ghi2) and sporulated, what is the expected number of tetrads of each type if 1,000 tetrads are examined? Neglect interference. In other words, per 1,000 tetrads, how many of each of the following types do you expect? tetrads with two GHI1 GHI2 spores and two ghi1 ghi2 spores; tetrads with two GHI1 ghi2 spores and two ghi1 GHI2 spores; and tetrads with one GHI1 GHI2 spore, one ghi1 ghi2 spore, one GHI1 ghi2 spore and one ghi1 GHI2 spore 4. Consider a family with three children in which both parents are carriers for cystic fibrosis. a) (1 pt.). What is the probability that they will have no affected children? b) (1 pt.). What is the probability that they will have exactly one affected child? c) (1 pt.). What is the probability that they will have exactly two affected children? d) (1 pt.). What is the probability that all three children will be affected?BSCI 410 Molecular Genetics Homework 1 and Review for the first exam. This homework 1 is due Tuesday, Sep. 23; the exam will be Thursday, Oct. 2, 2008 Coverage: Lectures 1-6 pg. 2 ------------------------------------------------------------------------------------------------------------- ------------------ 2 5. You carry out a study of families with cystic fibrosis children. Your study group consists of families with exactly three children that are full siblings, at least one of which has cystic fibrosis. You even verify that each child in the study is actually the genetic descendent of the two parents. The fraction of children in the study that are affected is greater than 1/4. Why is that? (the answer is known as "ascertainment bias"). (2 pts.) What fraction of children in the study population do you expect to be affected? 6. You are new to a laboratory that studies yeast. Your lab mate initiated a project with two closely linked genes, ABC1 and ABC2, that are involved in the same metabolic pathway. She previously measured the recombination rate between these two genes very precisely and deduced that when abc1 ABC2 / ABC1 abc2 heterozygous diploids are sporulated, almost exactly 1/1,000 of the resulting haploid cells are wild type (ABC1 ABC2). You repeat her experiment, sporulating 500 cells to yield 2,000 haploid spores, and find four recombinant ABC1 ABC2 spores. How likely is that (given the 1/1,000 expected rate)? In other words a) (1 pt.). What is the probability that you would obtain exactly four wild-type (ABC1 ABC2) spores? Calculate this answer exactly using the binomial distribution. b) (1 pt.). What is the probability that you would obtain four or more wild-type (ABC1 ABC2) spores? Calculate this answer exactly using the binomial distribution. c) (1 pt.) Once again, use the Poisson approximation to calculate your answer to a. What answer would you get? d) (1 pt.) Again assuming that the 1/1,000 number is precisely correct (for the expected number of recombinant ABC1 ABC2 haploids), how far apart are ABC1 and ABC2 (in cM.)? 7. A white-eyed beetle was crossed to a beetle with wild-type (dark red) eyes. The F1 progeny all had wild-type (dark red) eye color. When F1 males and females were crossed to each other, 47 beetles with dark red eyes and 13 beetles with white eyes were observed. a) (1 point) What pattern of dominance is likely based on this observation? b) (1 points) If you mate a pair of dark red-eyed F2 beetles what is the probability that some white-eyed progeney will be observed among the several dozen progeny for that specific mating? 8. (1 point) Two wild-type alleles, 1 and 2, are present in a population in Hardy-Weinberg equilibrium and together make up 96% of the allele frequency at that locus. Homozygotes for allele 1 represent 9% of the population. What fraction of the population is homozygous for allele 2? 9. (1 point) A single X-linked gene in a male cell during the G1 phase is present as part of a single (double-stranded) molecule. You are studying a protein that binds to a single site on the X chromosome only in males. The Drosophila genome is approximately 150 Mb., which means that a single haploid genome (one allele of each gene) would be 150,000,000 base pairs. Recalling that Avogadro's number is 6 x 1023 (no units; this is a "pure" number), how many diploid G1 male Drosphila cells would be needed to have 1 picomole of protein-DNA complex?BSCI 410 Molecular Genetics Homework 1 and Review for the first exam. This homework 1 is due Tuesday, Sep. 23; the exam will be Thursday, Oct. 2, 2008 Coverage: Lectures 1-6 pg. 3 -------------------------------------------------------------------------------------------------------------