Steps in Diagnostic Marker DevelopmentUse of Genomics for Diagnostics/Detection Sequence based or hybridization-based methods for identificationSequence divergenceDifferences between pathovars,Races, isolatesDifferences between speciesDifferences between generaSteps in Genomics-based Diagnostic Marker Development1. Identify a target gene -amplify and sequence the ITS or -“anonymous DNA” fragment that will be polymorphic -”species-specific”,“pathovar-specific” or “race-specific” geneFactors in decision:Level of specificity neededThroughputCostsTechnology requiredAvailable information2. Determine detection method: sequence, gel electrophoresis, hybridizationSteps in Genomics-based Diagnostic Marker Development-Design primers that uniquely amplify the conserved &/or diverged sequences-Confirm primers with ePCR or BLAST: computational procedure that is used to identify sequence tagged sites (STSs), within DNA sequences. e-PCR looks for potential STSs in DNA sequences by searching for subsequences that closely match the PCR primers and have the correct order, orientation, and spacing that could represent the PCR primers used to generate known STSs. http://www.ncbi.nlm.nih.gov/sutils/e-pcr/-Perform PCR, possibly nested PCR; score for gene (presence/absence or size difference)-QC could involve sequencing the initial productsRibosomal DNA Diagnostic Markers-Obtain rDNA sequences from query genome and nearest relatives-CPGR-Genbank-rDNA databases-Ribosomal DNA Primer database (http://www.psb.ugent.be/rRNA/primers/index.html)-Ribosomal Databasehttp://rdp.cme.msu.edu/-RISSC database (Ribosomal Internal Spacer Sequence Collection) http://miracle.umh.es/rissc/-Align the sequences using a multiple sequence alignment tool-Design primers in the conserved region that flank the ITS-Perform PCR-Sequence the products-Align to query genome and all other sequences available-P. parasitica: Obligate biotroph-Diagnosis is delayed on seedlings until sporulation-Can develop a rapid, inexpensive assay for the pathogen?-Use rDNA as a marker for the species-Survey P. parasitca isolates for size and restriction fragment polymorphism in the ITS1, ITS2, and full ITS sequenceFig. 2 Physical map of Peronospora parasitica rDNA cluster. R = RsaI restriction sites (positions 242 and 527 within ITS2 amplicon); H = HaeIII restriction sites (positions 365 and 436 within ITS2 amplicon); S = Sau3AI restriction sites (position 85 within ITS1 amplicon; positions 390 and 461 within ITS2 amplicon) Casimiro, S., Moura, M., Zé-Zé, L., Tenreiro, R. & Monteiro, A.A. Internal transcribed spacer 2 amplicon as a molecular marker for identification of Peronospora parasitica (crucifer downy mildew).Journal of Applied Microbiology 96 (3), 579-587.doi: 10.1111/j.1365-2672.2004.02193.x Use of ITS as a diagnostic markerCasimiro, S., Moura, M., Zé-Zé, L., Tenreiro, R. & Monteiro, A.A. Internal transcribed spacer 2 amplicon as a molecular marker for identification of Peronospora parasitica (crucifer downy mildew).Journal of Applied Microbiology 96 (3), 579-587.doi: 10.1111/j.1365-2672.2004.02193.x Fig. 1 Internal transcribed spacer amplification profiles of Peronospora parasitica isolates. (a) ITS1. (b) ITS2. (c) Full ITS. Lanes 1, 16: 1 kb Plus DNA ladder. Lanes 2–15: isolates P501, P502, P505, P517, P519, P520, P521, P522, P523, P524, P525, P526, P527 and P528 ITS1ITS2FullITSDifferent P. parasitica isolates323 bp684 bp981 bpCasimiro, S., Moura, M., Zé-Zé, L., Tenreiro, R. & Monteiro, A.A. Internal transcribed spacer 2 amplicon as a molecular marker for identification of Peronospora parasitica (crucifer downy mildew).Journal of Applied Microbiology 96 (3), 579-587.doi: 10.1111/j.1365-2672.2004.02193.x Fig. 4 Multiplex PCR with three primers. Lanes 1 and 16: 1 kb Plus DNA ladder. Lanes 2 and 3: Tronchuda cabbage 'Algarvia', not infected and infected with Peronospora parasiticaisolate P501, respectively. Lane 4: host DNA (from Tronchuda cabbage 'Algarvia') mixed with Alternaria sp. and Phytophtora cinnamomi DNA. Lane 5: P. parasitica isolate P501. Lanes 6–15: other Brassica oleracea fungal pathogens (Alternaria sp., Phytophthoracinnamomi, Fusarium culmorum, Trichoderma sp., Phoma sp., Sordaria fimicola, Sclerotiniasclerotiarum, F. oxysporum, Mycosphaerella tassiana and Diaporthe phaseolorum, respectively) Cabbage0 Pp A/Pc Pp Al Pc FC T Ph Sf Ss Fo Mt DpOther Brassica pathogensCabbagePpPpUse of an Anonymous Sequence as a Diagnostic Marker-Expect the sequence will be polymorphic-Good candidates are simple sequence repeats (mono-, di-, tri-,tetra, etc nucleotide) due to the potential slippage of the DNA polymerase during replication-Simple to score, co-dominant, inexpensive-Macrophomina phaseolina: the causal agent of charcoal root or collar rot in soybean and cotton. -Used SSRs to examine genetic variability of different populations of M. phaseolina obtained from soybean and cotton grown in India and the USA. -Forty isolates could be clustered into three major groups corresponding to their hosts and geographical region. -The variability found within closely related isolates of M. phaseolinaindicated that such microsatellites are useful in population studies and represents a step towards identification of potential isolate diagnostic markers specific to soybean and cotton.Jana T,Sharma TR, Singh NK. SSR-based detection of genetic variability in the charcoal root rot pathogen Macrophomina phaseolina. Mycol Res. 2005 Jan;109(Pt 1):81-6Use of SSRs for Diagnostic Markers>TA3941_148305 GACCTCACCAAGCGTAACGATAACCCCGCTCAGTACTCGAGTCTCACCCCGACGCCCCCG GCCGGCGCCATGCCAAACAAGCAACTAGGCTACAGTACCGGAGCGAACGTTGCTCCCCCG AGGCAGATGCAGCAGCAGCAGCAGCCTATGCAGCGCACTAACAACTATCCAAACATGTCT GGTGGTGGGTTACCGCCCAACGCATCTGGTGCCCGTGGGCCTTCCCCGCCCGATCCCCAGCAGCAGCAGAGGCAGCAGATGCAGAACATGTCTTCTAATTATATCAATCAAGGGGATCCG AACCGTGACGCGGAACGGCAGAGGCAGGCCGAGGCAGCTCAGCGACAGCGCATGATGGAG ATCGAGGAGCAGAACCGTCGCGATCTCGAGGCCTACAATGCTTCTATTCCGCAGACGAAG AAGCCGATAGCACAGCAAGAGATCGGTGGGTACGGCGGAGCGCCTTCTTCATCTGCAGAC CGTTTCAACCCCAACAGGGCACCTCCTCCTGCGCCCAAGCCTACAGCTCAACAATCCAAC CTCCAAGCACAGCGTCCTGCTCCACGAGCCCCGAACGCCGCCGGTGGTCCACGACCTGGA ATCTCGCAACAAAACAGTTCACAAAACGTGCGGGATCCTGCATCACAGCAACAACAGCGT GTCCCACCTCGCAACGACCAGTCCCCGAATGCGCAGAGGTATCCCAACGGTGGACCCGCA CCCCAGCCTCGCACCAACGGTCAACCCCAGAACCAACAGCCATCGCGCTTGCCTGCGCCT GTTAAACCTCTCAATGTCGCGCCCAAGCCTGCAGCGCAATCTGATGCAGTCAGGGCGGCT GAGGCTGCGTTGACTGCGAAGCCGCCCGCACAGGAGCGGCAGAAAGACGTCCGCATGTCA