NORTH BIOL& 260 - Microbial Genetics: DNA and RNA (22 pages)

Previewing pages 1, 2, 21, 22 of 22 page document View the full content.
View Full Document

Microbial Genetics: DNA and RNA



Previewing pages 1, 2, 21, 22 of actual document.

View the full content.
View Full Document
Unformatted text preview:

Microbial Genetics DNA and RNA What chemical carries the genetic instructions in cells and how is this chemical reproduced How is this chemical used inside the cell to direct the production of new molecules The Need for Protein Making Instructions Phenotype genotype environment 1 chromosome gene 1 protein DNA RNA copy protein production Structure of DNA The Genetic Material Two polynucleotide strands with H bonds RNA is single stranded difft sugar uracil How DNA copies itself when a cell divides DNA replication by unzipping DNA polymerase enzyme synthesizes new complementary strands 2 new helices Transcription Making a short DNA copy DNA protein make up a chromosome RNA polymerase makes RNA from DNA Only one set of instructions gene is copied Copy is complementary to the DNA gene In eukaryotes the RNA copy is edited The Three Kinds of RNA mRNA carries instructions for 1 protein rRNA structural support in ribosomes tRNA amino acid trucks with anticodons Steps of Translation Protein Synthesis DNA the genetic material replicates by semiconservative replication It is further copied in transcription for use in building proteins for the cell Flow of Genetic Information Figure 8 2 DNA is a Double Stranded Chain of Nucleotides DNA Figure 8 4 Microbial Genetics DNA and RNA What chemical carries the genetic instructions in cells and how is this chemical reproduced How is this chemical used inside the cell to direct the production of new molecules The Need for Protein Making Instructions Phenotype genotype environment 1 chromosome gene 1 protein DNA RNA copy protein production Structure of DNA The Genetic Material Two polynucleotide strands with H bonds DNA protein make up a chromosome RNA is single stranded difft sugar uracil How DNA copies itself when a cell divides DNA replication by unzipping DNA polymerase enzyme synthesizes new complementary strands 2 new helices Transcription Making a short DNA copy RNA polymerase makes RNA from DNA Only one set of instructions gene is copied Copy is complementary to the DNA gene In eukaryotes the RNA copy is edited The Three Kinds of RNA mRNA carries instructions for 1 protein rRNA structural support in ribosomes tRNA amino acid trucks with anticodons DNA the genetic material replicates by semiconservative replication It is further copied in transcription for use in building proteins for the cell DNA Replication is Semiconservative Figure 8 3 DNA DNA replication is semiconservative Figure 8 7 DNA Replication Involves Several Enzymes Figure 8 6 Central Dogma are of Biology How Shape Form Are Dictated By DNA Genes DNA Genes Instructions for and Making Specific Polypeptides Genotype The genes carried in a cell for a particular trait Phenotype The physical expression of genes for a particular trait QuickTime and a decompressor are needed to see this picture A segment of DNA gene carries specific coded instructions for the making of a single proteins Microbial Genetics DNA and RNA What chemical carries the genetic instructions in cells and how is this chemical reproduced How is this chemical used inside the cell to direct the production of new molecules The Need for Protein Making Instructions Phenotype genotype environment 1 chromosome gene 1 protein DNA RNA copy protein production Structure of DNA The Genetic Material Two polynucleotide strands with H bonds DNA protein make up a chromosome RNA is single stranded difft sugar uracil How DNA copies itself when a cell divides DNA replication by unzipping DNA polymerase enzyme synthesizes new complementary strands 2 new helices Transcription Making a short DNA copy RNA polymerase makes RNA from DNA Only one set of instructions gene is copied Copy is complementary to the DNA gene In eukaryotes the RNA copy is edited The Three Kinds of RNA mRNA carries instructions for 1 protein rRNA structural support in ribosomes tRNA amino acid trucks with anticodons DNA the genetic material replicates by semiconservative replication It is further copied in transcription for use in building proteins for the cell Transcription is Performed by RNA Polymerase Translation or Protein Synthesis Figure 8 2 Anatomy ofaaChain Messenger RNA mRNA is of Nucleotides Trailer Leader Figure 10 17 Microbial Genetics DNA and RNA What chemical carries the genetic instructions in cells and how is this chemical reproduced How is this chemical used inside the cell to direct the production of new molecules The Need for Protein Making Instructions Phenotype genotype environment 1 chromosome gene 1 protein DNA RNA copy protein production Structure of DNA The Genetic Material Two polynucleotide strands with H bonds DNA protein make up a chromosome RNA is single stranded difft sugar uracil How DNA copies itself when a cell divides DNA replication by unzipping DNA polymerase enzyme synthesizes new complementary strands 2 new helices Transcription Making a short DNA copy RNA polymerase makes RNA from DNA Only one set of instructions gene is copied Copy is complementary to the DNA gene In eukaryotes the RNA copy is edited The Three Kinds of RNA mRNA carries instructions for 1 protein rRNA structural support in ribosomes tRNA amino acid trucks with anticodons DNA the genetic material replicates by semiconservative replication It is further copied in transcription for use in building proteins for the cell 3 Types of RNA Each With a Different Job Messenger RNA mRNA Carries copy of gene information to the ribosome to make protein Transfer RNA tRNA anticodon CUG CUG Carries amino acids to the ribosome for linking identified by anticodon sign Ribosomal RNA rRNA Part of the structure of the ribosome key component in amino acid linking machinery How Gene Instructions are Communicated mRNA Codon Dictionary of the Genetic Code Central Dogma DNA RNA Protein DNA template strand CGTTTACGACCGGCCTTAGATCCTGACG Transcription mRNA GCAAAUGCUGGCCGGAAUCUAGGACUGC Translation Protein by RNA polymerase by ribosome Met Leu Ala Gly Ile Translation in Prokaryotes Can Occur Simultaneously With Transcription Figure 8 11 A Ribosome Has Two Subunits and Three tRNA Binding Sites Translation Initiation Elongation Termination Initiation Elongation 3 4 steps Termination Steps of Translation Protein Synthesis Movie


View Full Document

Access the best Study Guides, Lecture Notes and Practice Exams

Loading Unlocking...
Login

Join to view Microbial Genetics: DNA and RNA and access 3M+ class-specific study document.

or
We will never post anything without your permission.
Don't have an account?
Sign Up

Join to view Microbial Genetics: DNA and RNA and access 3M+ class-specific study document.

or

By creating an account you agree to our Privacy Policy and Terms Of Use

Already a member?